FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631537_at:

>probe:Drosophila_2:1631537_at:384:11; Interrogation_Position=2448; Antisense; ATTCGGTTGCGTCAAGACCCAGTCT
>probe:Drosophila_2:1631537_at:187:399; Interrogation_Position=2519; Antisense; GACAGGACAAGTCATCCGTGCTGGC
>probe:Drosophila_2:1631537_at:238:581; Interrogation_Position=2540; Antisense; TGGCCACTCTCTACACGGAGAACAA
>probe:Drosophila_2:1631537_at:15:423; Interrogation_Position=2566; Antisense; GAGAATGTCAGTCCGGTGTTTGCAC
>probe:Drosophila_2:1631537_at:622:533; Interrogation_Position=2580; Antisense; GGTGTTTGCACTGGTCACTCAGAAA
>probe:Drosophila_2:1631537_at:540:285; Interrogation_Position=2642; Antisense; CTGTGGCCACGGTGATTTCCAATAT
>probe:Drosophila_2:1631537_at:156:657; Interrogation_Position=2724; Antisense; TAATGGCGCCAAGTTCGGCAGCTCG
>probe:Drosophila_2:1631537_at:51:319; Interrogation_Position=2764; Antisense; GCCGCCGAGGCAACCGTTAAGGAGA
>probe:Drosophila_2:1631537_at:305:117; Interrogation_Position=2827; Antisense; AGCTATCTGGCCAACTATCGTAGTG
>probe:Drosophila_2:1631537_at:52:35; Interrogation_Position=2881; Antisense; ATCAGCCTTTTGATGGTGGCCCTGG
>probe:Drosophila_2:1631537_at:698:285; Interrogation_Position=2902; Antisense; CTGGTCACCATGCTGCGTAACTAAG
>probe:Drosophila_2:1631537_at:280:113; Interrogation_Position=2925; Antisense; AGCAGGGATTAGCTCCTACTGGAGT
>probe:Drosophila_2:1631537_at:378:651; Interrogation_Position=2964; Antisense; TCACGAGTGCTCCTTAGGCCATAAA
>probe:Drosophila_2:1631537_at:451:481; Interrogation_Position=2989; Antisense; GTATTTGTACGCAAGAGCACCCAAT

Paste this into a BLAST search page for me
ATTCGGTTGCGTCAAGACCCAGTCTGACAGGACAAGTCATCCGTGCTGGCTGGCCACTCTCTACACGGAGAACAAGAGAATGTCAGTCCGGTGTTTGCACGGTGTTTGCACTGGTCACTCAGAAACTGTGGCCACGGTGATTTCCAATATTAATGGCGCCAAGTTCGGCAGCTCGGCCGCCGAGGCAACCGTTAAGGAGAAGCTATCTGGCCAACTATCGTAGTGATCAGCCTTTTGATGGTGGCCCTGGCTGGTCACCATGCTGCGTAACTAAGAGCAGGGATTAGCTCCTACTGGAGTTCACGAGTGCTCCTTAGGCCATAAAGTATTTGTACGCAAGAGCACCCAAT

Full Affymetrix probeset data:

Annotations for 1631537_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720