FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631539_at:

>probe:Drosophila_2:1631539_at:229:203; Interrogation_Position=133; Antisense; AAGCCGGTGGCCAAGTTCTTTGTGA
>probe:Drosophila_2:1631539_at:587:143; Interrogation_Position=158; Antisense; ACATGCGAATTGTTTTACCCCGACG
>probe:Drosophila_2:1631539_at:361:671; Interrogation_Position=173; Antisense; TACCCCGACGATTTGGCGATGACTT
>probe:Drosophila_2:1631539_at:280:671; Interrogation_Position=198; Antisense; TACGCTGTTTAATCTATCCGGAATC
>probe:Drosophila_2:1631539_at:381:441; Interrogation_Position=223; Antisense; GATGGTTGTAGTCTGCTGTCGAACA
>probe:Drosophila_2:1631539_at:673:237; Interrogation_Position=250; Antisense; AATCAGATCGCCTTCATTCAACTGG
>probe:Drosophila_2:1631539_at:11:595; Interrogation_Position=272; Antisense; TGGGCCGCAAGCATATGGATCGATT
>probe:Drosophila_2:1631539_at:724:491; Interrogation_Position=299; Antisense; GTAACATACCCAAGCGATGTCCTTG
>probe:Drosophila_2:1631539_at:41:21; Interrogation_Position=344; Antisense; ATATTCGTGGATTCCGTTCGGATAT
>probe:Drosophila_2:1631539_at:14:473; Interrogation_Position=359; Antisense; GTTCGGATATGGCTACCATGCCGGC
>probe:Drosophila_2:1631539_at:618:267; Interrogation_Position=375; Antisense; CATGCCGGCCTTTAATTTCGAAACG
>probe:Drosophila_2:1631539_at:666:237; Interrogation_Position=406; Antisense; AATCTGTGGTTCGAGCTTGTTGTGA
>probe:Drosophila_2:1631539_at:667:263; Interrogation_Position=433; Antisense; CAGCACAAGTTGATTCGCGGATTTA
>probe:Drosophila_2:1631539_at:485:227; Interrogation_Position=99; Antisense; AAGGCCGTCCTTCAATATCGAGCTG

Paste this into a BLAST search page for me
AAGCCGGTGGCCAAGTTCTTTGTGAACATGCGAATTGTTTTACCCCGACGTACCCCGACGATTTGGCGATGACTTTACGCTGTTTAATCTATCCGGAATCGATGGTTGTAGTCTGCTGTCGAACAAATCAGATCGCCTTCATTCAACTGGTGGGCCGCAAGCATATGGATCGATTGTAACATACCCAAGCGATGTCCTTGATATTCGTGGATTCCGTTCGGATATGTTCGGATATGGCTACCATGCCGGCCATGCCGGCCTTTAATTTCGAAACGAATCTGTGGTTCGAGCTTGTTGTGACAGCACAAGTTGATTCGCGGATTTAAAGGCCGTCCTTCAATATCGAGCTG

Full Affymetrix probeset data:

Annotations for 1631539_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720