FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631543_at:

>probe:Drosophila_2:1631543_at:424:25; Interrogation_Position=3134; Antisense; ATATGTGTGGCCAATTCGCCGACGC
>probe:Drosophila_2:1631543_at:728:199; Interrogation_Position=3160; Antisense; AACGCAGAGCCATCTATTGGAGCCA
>probe:Drosophila_2:1631543_at:429:723; Interrogation_Position=3197; Antisense; TTGGAGGCGGACACCACAACGTTGA
>probe:Drosophila_2:1631543_at:174:411; Interrogation_Position=3220; Antisense; GACGCCCGTCGAGCAAAACTGGTGT
>probe:Drosophila_2:1631543_at:666:579; Interrogation_Position=3288; Antisense; TGGCCACTTTGTCCGTAACCAACAG
>probe:Drosophila_2:1631543_at:702:229; Interrogation_Position=3347; Antisense; AATGTGCCCGATTTGGTGCGAATCA
>probe:Drosophila_2:1631543_at:552:507; Interrogation_Position=3362; Antisense; GTGCGAATCAGTCCCAGTGAGTGCT
>probe:Drosophila_2:1631543_at:124:85; Interrogation_Position=3377; Antisense; AGTGAGTGCTACGTATCCCCGGATG
>probe:Drosophila_2:1631543_at:105:651; Interrogation_Position=3437; Antisense; TCACCCAGGCAGGATTTGCTCGAAA
>probe:Drosophila_2:1631543_at:323:169; Interrogation_Position=3459; Antisense; AAAGGGAGCCGCTCATTGTGGTCTC
>probe:Drosophila_2:1631543_at:198:389; Interrogation_Position=3488; Antisense; GAAAACGAGCGCATCAGTGTCCCGA
>probe:Drosophila_2:1631543_at:290:689; Interrogation_Position=3539; Antisense; TATTTGTGCCTGCTAATTCTGCTTT
>probe:Drosophila_2:1631543_at:401:11; Interrogation_Position=3554; Antisense; ATTCTGCTTTCCCTATGTTTGTGTA
>probe:Drosophila_2:1631543_at:249:29; Interrogation_Position=3671; Antisense; ATACTCGCTTGTTTCCTAAAAGTTG

Paste this into a BLAST search page for me
ATATGTGTGGCCAATTCGCCGACGCAACGCAGAGCCATCTATTGGAGCCATTGGAGGCGGACACCACAACGTTGAGACGCCCGTCGAGCAAAACTGGTGTTGGCCACTTTGTCCGTAACCAACAGAATGTGCCCGATTTGGTGCGAATCAGTGCGAATCAGTCCCAGTGAGTGCTAGTGAGTGCTACGTATCCCCGGATGTCACCCAGGCAGGATTTGCTCGAAAAAAGGGAGCCGCTCATTGTGGTCTCGAAAACGAGCGCATCAGTGTCCCGATATTTGTGCCTGCTAATTCTGCTTTATTCTGCTTTCCCTATGTTTGTGTAATACTCGCTTGTTTCCTAAAAGTTG

Full Affymetrix probeset data:

Annotations for 1631543_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720