FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631546_at:

>probe:Drosophila_2:1631546_at:650:445; Interrogation_Position=302; Antisense; GATGCCCACGCCGAACGGGAAGGAT
>probe:Drosophila_2:1631546_at:301:89; Interrogation_Position=328; Antisense; AGTAATCGCAGGCTACTACGCAGCA
>probe:Drosophila_2:1631546_at:315:671; Interrogation_Position=344; Antisense; TACGCAGCACCGGAGAACTTCTACG
>probe:Drosophila_2:1631546_at:293:383; Interrogation_Position=421; Antisense; GAACTTCAAGAACGCCTGCTTTGTG
>probe:Drosophila_2:1631546_at:721:175; Interrogation_Position=458; Antisense; AAACTGATGACGCTGCAGCACGACC
>probe:Drosophila_2:1631546_at:446:47; Interrogation_Position=491; Antisense; ATCCAGGTATTCAACTGTCCCGGAG
>probe:Drosophila_2:1631546_at:439:597; Interrogation_Position=506; Antisense; TGTCCCGGAGACTCTGGAGCAAGGT
>probe:Drosophila_2:1631546_at:657:493; Interrogation_Position=532; Antisense; GTCAAAGGCCAAGTTTACGCTCTCA
>probe:Drosophila_2:1631546_at:148:643; Interrogation_Position=552; Antisense; TCTCACAGGCGTCCGATACATTGGA
>probe:Drosophila_2:1631546_at:95:271; Interrogation_Position=607; Antisense; CATGCGGGATTTGGTTGACTTTGAC
>probe:Drosophila_2:1631546_at:551:587; Interrogation_Position=659; Antisense; TGGACCAACGACTTCCTGAATCAGC
>probe:Drosophila_2:1631546_at:419:615; Interrogation_Position=675; Antisense; TGAATCAGCCGCTCAACGATCTGCA
>probe:Drosophila_2:1631546_at:403:327; Interrogation_Position=697; Antisense; GCAGAAACTGTACTAGTCGTCCGTT
>probe:Drosophila_2:1631546_at:233:557; Interrogation_Position=766; Antisense; GGAACATGCCGGAATTTCAACCTTG

Paste this into a BLAST search page for me
GATGCCCACGCCGAACGGGAAGGATAGTAATCGCAGGCTACTACGCAGCATACGCAGCACCGGAGAACTTCTACGGAACTTCAAGAACGCCTGCTTTGTGAAACTGATGACGCTGCAGCACGACCATCCAGGTATTCAACTGTCCCGGAGTGTCCCGGAGACTCTGGAGCAAGGTGTCAAAGGCCAAGTTTACGCTCTCATCTCACAGGCGTCCGATACATTGGACATGCGGGATTTGGTTGACTTTGACTGGACCAACGACTTCCTGAATCAGCTGAATCAGCCGCTCAACGATCTGCAGCAGAAACTGTACTAGTCGTCCGTTGGAACATGCCGGAATTTCAACCTTG

Full Affymetrix probeset data:

Annotations for 1631546_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720