FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631548_at:

>probe:Drosophila_2:1631548_at:522:95; Interrogation_Position=108; Antisense; AGTTGGAGTGTCCAGCCTGCCAGCA
>probe:Drosophila_2:1631548_at:227:95; Interrogation_Position=132; Antisense; AGTTGCAGACTACCCACGTGAAATC
>probe:Drosophila_2:1631548_at:531:509; Interrogation_Position=164; Antisense; GTGACCGTTCTGCAGAAGATTGCCT
>probe:Drosophila_2:1631548_at:557:215; Interrogation_Position=179; Antisense; AAGATTGCCTGCTCGCTGAATGTGC
>probe:Drosophila_2:1631548_at:475:615; Interrogation_Position=195; Antisense; TGAATGTGCTTCTCTGCTGTAATCC
>probe:Drosophila_2:1631548_at:560:653; Interrogation_Position=214; Antisense; TAATCCCATTCGCTGGAAGGGCCGT
>probe:Drosophila_2:1631548_at:279:373; Interrogation_Position=229; Antisense; GAAGGGCCGTCATGATGTCAATCAC
>probe:Drosophila_2:1631548_at:2:599; Interrogation_Position=244; Antisense; TGTCAATCACTACTGCAGCTCATGT
>probe:Drosophila_2:1631548_at:119:117; Interrogation_Position=260; Antisense; AGCTCATGTGGCTGTTTCATTGGAC
>probe:Drosophila_2:1631548_at:666:3; Interrogation_Position=278; Antisense; ATTGGACGCGATATCACTCTGAGTT
>probe:Drosophila_2:1631548_at:189:411; Interrogation_Position=354; Antisense; GACGCTGGCAGAGATTCCGCAAGGT
>probe:Drosophila_2:1631548_at:472:155; Interrogation_Position=415; Antisense; ACAGCGCAAGGCCATCGAATCGAAG
>probe:Drosophila_2:1631548_at:726:149; Interrogation_Position=60; Antisense; ACATCTCATCCATTCCGCAAGTGGG
>probe:Drosophila_2:1631548_at:498:127; Interrogation_Position=92; Antisense; ACCACTGAGCCCCAGGAGTTGGAGT

Paste this into a BLAST search page for me
AGTTGGAGTGTCCAGCCTGCCAGCAAGTTGCAGACTACCCACGTGAAATCGTGACCGTTCTGCAGAAGATTGCCTAAGATTGCCTGCTCGCTGAATGTGCTGAATGTGCTTCTCTGCTGTAATCCTAATCCCATTCGCTGGAAGGGCCGTGAAGGGCCGTCATGATGTCAATCACTGTCAATCACTACTGCAGCTCATGTAGCTCATGTGGCTGTTTCATTGGACATTGGACGCGATATCACTCTGAGTTGACGCTGGCAGAGATTCCGCAAGGTACAGCGCAAGGCCATCGAATCGAAGACATCTCATCCATTCCGCAAGTGGGACCACTGAGCCCCAGGAGTTGGAGT

Full Affymetrix probeset data:

Annotations for 1631548_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720