Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631550_at:

>probe:Drosophila_2:1631550_at:508:287; Interrogation_Position=3863; Antisense; CTGGACTACAACACCGGTGAGTGGA
>probe:Drosophila_2:1631550_at:714:401; Interrogation_Position=3889; Antisense; GACATTCCAAAACTACAGGCTGCAG
>probe:Drosophila_2:1631550_at:473:667; Interrogation_Position=3902; Antisense; TACAGGCTGCAGGACCAGAGTGCCG
>probe:Drosophila_2:1631550_at:34:101; Interrogation_Position=3918; Antisense; AGAGTGCCGCCTCATATCAGCAAGA
>probe:Drosophila_2:1631550_at:40:103; Interrogation_Position=3940; Antisense; AGACGCCCTAAGAAATGCTGGATAT
>probe:Drosophila_2:1631550_at:440:267; Interrogation_Position=4049; Antisense; CAGGCCCGTTCGTACATCCATAAAA
>probe:Drosophila_2:1631550_at:373:31; Interrogation_Position=4068; Antisense; ATAAAAACACCCATTCATCCAAGCA
>probe:Drosophila_2:1631550_at:277:143; Interrogation_Position=4094; Antisense; ACTGGCATAATCACCTCTGGCTGAA
>probe:Drosophila_2:1631550_at:519:639; Interrogation_Position=4109; Antisense; TCTGGCTGAACGCTTCACTGGAGAG
>probe:Drosophila_2:1631550_at:315:481; Interrogation_Position=4166; Antisense; GTTTGGACGGATCACATAGGCACAC
>probe:Drosophila_2:1631550_at:640:157; Interrogation_Position=4191; Antisense; ACACATGCCTCACACATGCATTTTA
>probe:Drosophila_2:1631550_at:138:245; Interrogation_Position=4292; Antisense; AATTTAGAGACGCTGATCGGCGCTC
>probe:Drosophila_2:1631550_at:690:451; Interrogation_Position=4306; Antisense; GATCGGCGCTCGTATTCATTAGAAA
>probe:Drosophila_2:1631550_at:466:687; Interrogation_Position=4360; Antisense; TATATGTATGAGTCGCAGCCACCAC

Paste this into a BLAST search page for me
CTGGACTACAACACCGGTGAGTGGAGACATTCCAAAACTACAGGCTGCAGTACAGGCTGCAGGACCAGAGTGCCGAGAGTGCCGCCTCATATCAGCAAGAAGACGCCCTAAGAAATGCTGGATATCAGGCCCGTTCGTACATCCATAAAAATAAAAACACCCATTCATCCAAGCAACTGGCATAATCACCTCTGGCTGAATCTGGCTGAACGCTTCACTGGAGAGGTTTGGACGGATCACATAGGCACACACACATGCCTCACACATGCATTTTAAATTTAGAGACGCTGATCGGCGCTCGATCGGCGCTCGTATTCATTAGAAATATATGTATGAGTCGCAGCCACCAC

Full Affymetrix probeset data:

Annotations for 1631550_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime