Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631552_at:

>probe:Drosophila_2:1631552_at:207:659; Interrogation_Position=1565; Antisense; TAACCGATCGAATTGAACTTGCCTC
>probe:Drosophila_2:1631552_at:564:297; Interrogation_Position=1573; Antisense; CGAATTGAACTTGCCTCAGCTGAAA
>probe:Drosophila_2:1631552_at:334:609; Interrogation_Position=1605; Antisense; TGAGACAACAGCGAACCCCGAAGGT
>probe:Drosophila_2:1631552_at:250:509; Interrogation_Position=1628; Antisense; GTGAGACAGAGACAGTTACTACCGA
>probe:Drosophila_2:1631552_at:120:475; Interrogation_Position=1642; Antisense; GTTACTACCGAAACTGTAATGCAGA
>probe:Drosophila_2:1631552_at:257:409; Interrogation_Position=1699; Antisense; GACGATAGCTATCCGAACGACGAGG
>probe:Drosophila_2:1631552_at:174:421; Interrogation_Position=1723; Antisense; GAGCACGAAGAGCTGATTCTAAAGA
>probe:Drosophila_2:1631552_at:353:173; Interrogation_Position=1743; Antisense; AAAGAAACTTCTTCGTGGCCTCAGG
>probe:Drosophila_2:1631552_at:602:639; Interrogation_Position=1755; Antisense; TCGTGGCCTCAGGTTGCAACAGCAA
>probe:Drosophila_2:1631552_at:633:271; Interrogation_Position=1870; Antisense; CATAACGATGGTGGTCTGCTGACAA
>probe:Drosophila_2:1631552_at:129:499; Interrogation_Position=1883; Antisense; GTCTGCTGACAAACAATAACCATAA
>probe:Drosophila_2:1631552_at:705:421; Interrogation_Position=1921; Antisense; GAGCAATTTGCGAATGACGATGAAA
>probe:Drosophila_2:1631552_at:363:455; Interrogation_Position=2041; Antisense; GATAATCCTATAATCATTGCTTGGC
>probe:Drosophila_2:1631552_at:187:565; Interrogation_Position=2063; Antisense; GGCAATTTGCATGTCACTGTGGTAA

Paste this into a BLAST search page for me
TAACCGATCGAATTGAACTTGCCTCCGAATTGAACTTGCCTCAGCTGAAATGAGACAACAGCGAACCCCGAAGGTGTGAGACAGAGACAGTTACTACCGAGTTACTACCGAAACTGTAATGCAGAGACGATAGCTATCCGAACGACGAGGGAGCACGAAGAGCTGATTCTAAAGAAAAGAAACTTCTTCGTGGCCTCAGGTCGTGGCCTCAGGTTGCAACAGCAACATAACGATGGTGGTCTGCTGACAAGTCTGCTGACAAACAATAACCATAAGAGCAATTTGCGAATGACGATGAAAGATAATCCTATAATCATTGCTTGGCGGCAATTTGCATGTCACTGTGGTAA

Full Affymetrix probeset data:

Annotations for 1631552_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime