FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631553_at:

>probe:Drosophila_2:1631553_at:657:51; Interrogation_Position=13; Antisense; ATGCAGTCTGCTCTCAAAGCATCGC
>probe:Drosophila_2:1631553_at:159:391; Interrogation_Position=157; Antisense; GAAACTCATGCAAAGTCGCGACAAG
>probe:Drosophila_2:1631553_at:199:219; Interrogation_Position=169; Antisense; AAGTCGCGACAAGAACTGGTCAACT
>probe:Drosophila_2:1631553_at:413:193; Interrogation_Position=182; Antisense; AACTGGTCAACTGCTTCAATGGTCC
>probe:Drosophila_2:1631553_at:38:193; Interrogation_Position=190; Antisense; AACTGCTTCAATGGTCCTCTTCTTT
>probe:Drosophila_2:1631553_at:405:229; Interrogation_Position=199; Antisense; AATGGTCCTCTTCTTTCCTCGCAGT
>probe:Drosophila_2:1631553_at:448:687; Interrogation_Position=212; Antisense; TTTCCTCGCAGTTTGTCCTTTTCAA
>probe:Drosophila_2:1631553_at:3:267; Interrogation_Position=220; Antisense; CAGTTTGTCCTTTTCAACGCTTTGA
>probe:Drosophila_2:1631553_at:20:201; Interrogation_Position=235; Antisense; AACGCTTTGAAGTTAGCTACACGGA
>probe:Drosophila_2:1631553_at:635:207; Interrogation_Position=29; Antisense; AAGCATCGCTAATTAGTTTTGCCAT
>probe:Drosophila_2:1631553_at:484:475; Interrogation_Position=44; Antisense; GTTTTGCCATTTCAATTAGCCCACC
>probe:Drosophila_2:1631553_at:388:707; Interrogation_Position=59; Antisense; TTAGCCCACCGATGTGTCGTCGAGA
>probe:Drosophila_2:1631553_at:532:291; Interrogation_Position=68; Antisense; CGATGTGTCGTCGAGATGGGACTTT
>probe:Drosophila_2:1631553_at:228:99; Interrogation_Position=81; Antisense; AGATGGGACTTTGGCTTTTGCCCAT

Paste this into a BLAST search page for me
ATGCAGTCTGCTCTCAAAGCATCGCGAAACTCATGCAAAGTCGCGACAAGAAGTCGCGACAAGAACTGGTCAACTAACTGGTCAACTGCTTCAATGGTCCAACTGCTTCAATGGTCCTCTTCTTTAATGGTCCTCTTCTTTCCTCGCAGTTTTCCTCGCAGTTTGTCCTTTTCAACAGTTTGTCCTTTTCAACGCTTTGAAACGCTTTGAAGTTAGCTACACGGAAAGCATCGCTAATTAGTTTTGCCATGTTTTGCCATTTCAATTAGCCCACCTTAGCCCACCGATGTGTCGTCGAGACGATGTGTCGTCGAGATGGGACTTTAGATGGGACTTTGGCTTTTGCCCAT

Full Affymetrix probeset data:

Annotations for 1631553_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720