Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631554_at:

>probe:Drosophila_2:1631554_at:652:249; Interrogation_Position=3671; Antisense; CAAATGGTTGTTTACTTTTCGCGTG
>probe:Drosophila_2:1631554_at:376:719; Interrogation_Position=3688; Antisense; TTCGCGTGTTTTTCGCGACTGCGAA
>probe:Drosophila_2:1631554_at:239:559; Interrogation_Position=3718; Antisense; GGAAATCCCCGTGACTATACACTGA
>probe:Drosophila_2:1631554_at:141:607; Interrogation_Position=3765; Antisense; TGATGCAATGCCATGAAGAACGCGG
>probe:Drosophila_2:1631554_at:710:381; Interrogation_Position=3782; Antisense; GAACGCGGCCACAGGAAACGGAAAT
>probe:Drosophila_2:1631554_at:526:11; Interrogation_Position=3845; Antisense; ATTCGATCTGATCTGACTTTTCCAC
>probe:Drosophila_2:1631554_at:129:285; Interrogation_Position=3857; Antisense; CTGACTTTTCCACCAATCGAGAACA
>probe:Drosophila_2:1631554_at:383:387; Interrogation_Position=3892; Antisense; GAACAACAGTAACAGCCGAACAACA
>probe:Drosophila_2:1631554_at:327:9; Interrogation_Position=3960; Antisense; ATTCGATTACATTTCTGTTCCCGAC
>probe:Drosophila_2:1631554_at:595:601; Interrogation_Position=3975; Antisense; TGTTCCCGACTTGATTTAAGCCTTT
>probe:Drosophila_2:1631554_at:152:703; Interrogation_Position=4016; Antisense; TTATTCTCAGCCACAAGTCACTAAC
>probe:Drosophila_2:1631554_at:225:257; Interrogation_Position=4027; Antisense; CACAAGTCACTAACTGAGTCGACAA
>probe:Drosophila_2:1631554_at:146:323; Interrogation_Position=4079; Antisense; GCGCTAAGACAACTTCATGGCCAAT
>probe:Drosophila_2:1631554_at:589:253; Interrogation_Position=4112; Antisense; CAAATTGCCCGAAACACCATTACTA

Paste this into a BLAST search page for me
CAAATGGTTGTTTACTTTTCGCGTGTTCGCGTGTTTTTCGCGACTGCGAAGGAAATCCCCGTGACTATACACTGATGATGCAATGCCATGAAGAACGCGGGAACGCGGCCACAGGAAACGGAAATATTCGATCTGATCTGACTTTTCCACCTGACTTTTCCACCAATCGAGAACAGAACAACAGTAACAGCCGAACAACAATTCGATTACATTTCTGTTCCCGACTGTTCCCGACTTGATTTAAGCCTTTTTATTCTCAGCCACAAGTCACTAACCACAAGTCACTAACTGAGTCGACAAGCGCTAAGACAACTTCATGGCCAATCAAATTGCCCGAAACACCATTACTA

Full Affymetrix probeset data:

Annotations for 1631554_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime