Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631555_at:

>probe:Drosophila_2:1631555_at:12:563; Interrogation_Position=2353; Antisense; GGAATCGCCAGAGATACCCACCGAA
>probe:Drosophila_2:1631555_at:196:365; Interrogation_Position=2375; Antisense; GAATATCCAATGCTGGTCCTGCAGG
>probe:Drosophila_2:1631555_at:698:503; Interrogation_Position=2390; Antisense; GTCCTGCAGGACTCTAGCGAACTAG
>probe:Drosophila_2:1631555_at:263:385; Interrogation_Position=2408; Antisense; GAACTAGAGACTTCCGCGCAGAGGA
>probe:Drosophila_2:1631555_at:233:77; Interrogation_Position=2429; Antisense; AGGAGATTCAACTTCACACTGGCCG
>probe:Drosophila_2:1631555_at:137:177; Interrogation_Position=2506; Antisense; AAACTGGTCCTTCAATGACACTCTC
>probe:Drosophila_2:1631555_at:79:425; Interrogation_Position=2535; Antisense; GAGAGCAGGCGGAACCACCGTATAT
>probe:Drosophila_2:1631555_at:349:399; Interrogation_Position=2585; Antisense; GACAGTCCTCTGGAATTTACCATCG
>probe:Drosophila_2:1631555_at:223:691; Interrogation_Position=2633; Antisense; TTTGACACGCCAACCCTAGAGATTG
>probe:Drosophila_2:1631555_at:115:533; Interrogation_Position=2673; Antisense; GGGTGACCCAGGATATCACTGCTAT
>probe:Drosophila_2:1631555_at:552:351; Interrogation_Position=2709; Antisense; GCAGCTACATCAATCGATTTCCGTC
>probe:Drosophila_2:1631555_at:173:13; Interrogation_Position=2725; Antisense; ATTTCCGTCGTATGCCTACATTCAG
>probe:Drosophila_2:1631555_at:472:589; Interrogation_Position=2753; Antisense; TGGGTTGGAACCTACGAGACCTGGT
>probe:Drosophila_2:1631555_at:470:425; Interrogation_Position=2768; Antisense; GAGACCTGGTACTTCTAAGCCAATA

Paste this into a BLAST search page for me
GGAATCGCCAGAGATACCCACCGAAGAATATCCAATGCTGGTCCTGCAGGGTCCTGCAGGACTCTAGCGAACTAGGAACTAGAGACTTCCGCGCAGAGGAAGGAGATTCAACTTCACACTGGCCGAAACTGGTCCTTCAATGACACTCTCGAGAGCAGGCGGAACCACCGTATATGACAGTCCTCTGGAATTTACCATCGTTTGACACGCCAACCCTAGAGATTGGGGTGACCCAGGATATCACTGCTATGCAGCTACATCAATCGATTTCCGTCATTTCCGTCGTATGCCTACATTCAGTGGGTTGGAACCTACGAGACCTGGTGAGACCTGGTACTTCTAAGCCAATA

Full Affymetrix probeset data:

Annotations for 1631555_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime