FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631556_at:

>probe:Drosophila_2:1631556_at:47:533; Interrogation_Position=109; Antisense; GGTGGCTATGCCTACCAGGTGCAGC
>probe:Drosophila_2:1631556_at:56:625; Interrogation_Position=135; Antisense; TGCCCTGACCGTTAAGGCGATCGTT
>probe:Drosophila_2:1631556_at:631:431; Interrogation_Position=153; Antisense; GATCGTTCCCTCATACGGTGGTGGA
>probe:Drosophila_2:1631556_at:523:29; Interrogation_Position=177; Antisense; ATACGGCGGAAACCATGGAGGATAT
>probe:Drosophila_2:1631556_at:48:277; Interrogation_Position=210; Antisense; CTACGAGTCGGTGCCTGTGCCCGTG
>probe:Drosophila_2:1631556_at:716:315; Interrogation_Position=241; Antisense; GCCTACAGCGGTGCCAATGTGGGAT
>probe:Drosophila_2:1631556_at:53:221; Interrogation_Position=256; Antisense; AATGTGGGATCTCAGTACTCCGGTT
>probe:Drosophila_2:1631556_at:464:287; Interrogation_Position=356; Antisense; CTGGAGCTCCTCTGGTCTGGAAGGA
>probe:Drosophila_2:1631556_at:546:587; Interrogation_Position=368; Antisense; TGGTCTGGAAGGAGGCTCCCCGCTA
>probe:Drosophila_2:1631556_at:152:309; Interrogation_Position=413; Antisense; CCACCAGCTACGTGAACCAGGAGTA
>probe:Drosophila_2:1631556_at:437:129; Interrogation_Position=428; Antisense; ACCAGGAGTACGGACACAGCGAGAA
>probe:Drosophila_2:1631556_at:680:81; Interrogation_Position=506; Antisense; AGGGCTACAAGAGGCCCAGCTACTA
>probe:Drosophila_2:1631556_at:643:623; Interrogation_Position=51; Antisense; TGCCGTTTCGGCCAACTCCTACGGA
>probe:Drosophila_2:1631556_at:262:629; Interrogation_Position=67; Antisense; TCCTACGGACGTTCCCGTGGTGGAT

Paste this into a BLAST search page for me
GGTGGCTATGCCTACCAGGTGCAGCTGCCCTGACCGTTAAGGCGATCGTTGATCGTTCCCTCATACGGTGGTGGAATACGGCGGAAACCATGGAGGATATCTACGAGTCGGTGCCTGTGCCCGTGGCCTACAGCGGTGCCAATGTGGGATAATGTGGGATCTCAGTACTCCGGTTCTGGAGCTCCTCTGGTCTGGAAGGATGGTCTGGAAGGAGGCTCCCCGCTACCACCAGCTACGTGAACCAGGAGTAACCAGGAGTACGGACACAGCGAGAAAGGGCTACAAGAGGCCCAGCTACTATGCCGTTTCGGCCAACTCCTACGGATCCTACGGACGTTCCCGTGGTGGAT

Full Affymetrix probeset data:

Annotations for 1631556_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720