FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631558_at:

>probe:Drosophila_2:1631558_at:590:637; Interrogation_Position=113; Antisense; TCGAGGTCCTGCGATCGGATAGCAA
>probe:Drosophila_2:1631558_at:124:451; Interrogation_Position=125; Antisense; GATCGGATAGCAATGTTGGAATCGA
>probe:Drosophila_2:1631558_at:136:565; Interrogation_Position=142; Antisense; GGAATCGATAACTACTCATATGCAG
>probe:Drosophila_2:1631558_at:259:25; Interrogation_Position=159; Antisense; ATATGCAGTTGAAACCAGCGACGGT
>probe:Drosophila_2:1631558_at:617:309; Interrogation_Position=173; Antisense; CCAGCGACGGTACCTCGAAGAGCGA
>probe:Drosophila_2:1631558_at:283:5; Interrogation_Position=22; Antisense; ATTGAGTCTTCAACGATCTACCACG
>probe:Drosophila_2:1631558_at:654:567; Interrogation_Position=220; Antisense; GGCACCGAGCTAGAGGCCATCTCAA
>probe:Drosophila_2:1631558_at:684:115; Interrogation_Position=227; Antisense; AGCTAGAGGCCATCTCAACCCACGG
>probe:Drosophila_2:1631558_at:655:629; Interrogation_Position=253; Antisense; TCCTTCAGCTACGTGGGCCCTGATG
>probe:Drosophila_2:1631558_at:508:139; Interrogation_Position=263; Antisense; ACGTGGGCCCTGATGGCCAGACCTA
>probe:Drosophila_2:1631558_at:316:343; Interrogation_Position=348; Antisense; TGCCCCCGTTGCCTAAGTTAAGGAG
>probe:Drosophila_2:1631558_at:321:453; Interrogation_Position=36; Antisense; GATCTACCACGTCTTCAATATGAAA
>probe:Drosophila_2:1631558_at:688:249; Interrogation_Position=51; Antisense; CAATATGAAATTCGCCATCGTCCTG
>probe:Drosophila_2:1631558_at:175:583; Interrogation_Position=98; Antisense; TGGCTGCCCCTACTGTCGAGGTCCT

Paste this into a BLAST search page for me
TCGAGGTCCTGCGATCGGATAGCAAGATCGGATAGCAATGTTGGAATCGAGGAATCGATAACTACTCATATGCAGATATGCAGTTGAAACCAGCGACGGTCCAGCGACGGTACCTCGAAGAGCGAATTGAGTCTTCAACGATCTACCACGGGCACCGAGCTAGAGGCCATCTCAAAGCTAGAGGCCATCTCAACCCACGGTCCTTCAGCTACGTGGGCCCTGATGACGTGGGCCCTGATGGCCAGACCTATGCCCCCGTTGCCTAAGTTAAGGAGGATCTACCACGTCTTCAATATGAAACAATATGAAATTCGCCATCGTCCTGTGGCTGCCCCTACTGTCGAGGTCCT

Full Affymetrix probeset data:

Annotations for 1631558_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720