FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631562_at:

>probe:Drosophila_2:1631562_at:325:547; Interrogation_Position=1026; Antisense; GGAATCGTCGTTGCGAAGCCAGGAA
>probe:Drosophila_2:1631562_at:280:289; Interrogation_Position=1075; Antisense; CGGAAGTTCTATTTGCTCTGGACGC
>probe:Drosophila_2:1631562_at:124:387; Interrogation_Position=1112; Antisense; GAACACAGCAACTGGGCGCCTTTGG
>probe:Drosophila_2:1631562_at:680:321; Interrogation_Position=1127; Antisense; GCGCCTTTGGGCTAATCCAAGTCAA
>probe:Drosophila_2:1631562_at:203:233; Interrogation_Position=1173; Antisense; AATGCAGCTGGCCTATAGACTCTTC
>probe:Drosophila_2:1631562_at:341:103; Interrogation_Position=1189; Antisense; AGACTCTTCACTTTTCTCAAATCTC
>probe:Drosophila_2:1631562_at:473:729; Interrogation_Position=685; Antisense; TTGGTCATGCATTTGGGCCATCTTG
>probe:Drosophila_2:1631562_at:125:439; Interrogation_Position=792; Antisense; GAGGCAGCAGCTTCTTAATGGATTG
>probe:Drosophila_2:1631562_at:312:709; Interrogation_Position=839; Antisense; TTAAAGTGGCCTTCCTGGTGAGCAA
>probe:Drosophila_2:1631562_at:199:609; Interrogation_Position=857; Antisense; TGAGCAATTTTGTAGGCGCCGGTTC
>probe:Drosophila_2:1631562_at:629:673; Interrogation_Position=892; Antisense; TACCTCTTTATGCTCTCGGAGACAT
>probe:Drosophila_2:1631562_at:139:597; Interrogation_Position=921; Antisense; TGTCCTTATCATCGCCCAGTATATA
>probe:Drosophila_2:1631562_at:543:685; Interrogation_Position=942; Antisense; TATATTACCCACTTTGGTCCTGGTG
>probe:Drosophila_2:1631562_at:160:505; Interrogation_Position=958; Antisense; GTCCTGGTGGGCTTCACATTTGAGA

Paste this into a BLAST search page for me
GGAATCGTCGTTGCGAAGCCAGGAACGGAAGTTCTATTTGCTCTGGACGCGAACACAGCAACTGGGCGCCTTTGGGCGCCTTTGGGCTAATCCAAGTCAAAATGCAGCTGGCCTATAGACTCTTCAGACTCTTCACTTTTCTCAAATCTCTTGGTCATGCATTTGGGCCATCTTGGAGGCAGCAGCTTCTTAATGGATTGTTAAAGTGGCCTTCCTGGTGAGCAATGAGCAATTTTGTAGGCGCCGGTTCTACCTCTTTATGCTCTCGGAGACATTGTCCTTATCATCGCCCAGTATATATATATTACCCACTTTGGTCCTGGTGGTCCTGGTGGGCTTCACATTTGAGA

Full Affymetrix probeset data:

Annotations for 1631562_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720