FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631564_at:

>probe:Drosophila_2:1631564_at:187:135; Interrogation_Position=5094; Antisense; ACGAGAGAGGAAGAGCTGTAAACAA
>probe:Drosophila_2:1631564_at:461:431; Interrogation_Position=5180; Antisense; GAGTCACCAAACGAGACGCAAGATA
>probe:Drosophila_2:1631564_at:250:105; Interrogation_Position=5212; Antisense; AGACGATGGCGGTGGATATATATAT
>probe:Drosophila_2:1631564_at:99:23; Interrogation_Position=5237; Antisense; ATATATGCATATATTCGAGCAGCAA
>probe:Drosophila_2:1631564_at:484:43; Interrogation_Position=5262; Antisense; ATCGAAAGAGATGGCAAAGGCGTAT
>probe:Drosophila_2:1631564_at:31:169; Interrogation_Position=5277; Antisense; AAAGGCGTATGTATGGGAGATGAAA
>probe:Drosophila_2:1631564_at:393:357; Interrogation_Position=5364; Antisense; GCAAAGGACTAGACAACATAAAATT
>probe:Drosophila_2:1631564_at:293:155; Interrogation_Position=5409; Antisense; ACACAGTTTAGTGCTTTTTCTTTGT
>probe:Drosophila_2:1631564_at:190:371; Interrogation_Position=5446; Antisense; GAAGGAATCGAGATCCGCGTCCGCG
>probe:Drosophila_2:1631564_at:388:425; Interrogation_Position=5513; Antisense; GAGAGCCAACAAGAAATCATATTTT
>probe:Drosophila_2:1631564_at:252:687; Interrogation_Position=5532; Antisense; TATTTTATTAATCTACTACCGCTAT
>probe:Drosophila_2:1631564_at:587:13; Interrogation_Position=5538; Antisense; ATTAATCTACTACCGCTATATGCTA
>probe:Drosophila_2:1631564_at:493:147; Interrogation_Position=5546; Antisense; ACTACCGCTATATGCTATTATTATT
>probe:Drosophila_2:1631564_at:226:185; Interrogation_Position=5635; Antisense; AAAATACCAAGAATTCAACTGACAA

Paste this into a BLAST search page for me
ACGAGAGAGGAAGAGCTGTAAACAAGAGTCACCAAACGAGACGCAAGATAAGACGATGGCGGTGGATATATATATATATATGCATATATTCGAGCAGCAAATCGAAAGAGATGGCAAAGGCGTATAAAGGCGTATGTATGGGAGATGAAAGCAAAGGACTAGACAACATAAAATTACACAGTTTAGTGCTTTTTCTTTGTGAAGGAATCGAGATCCGCGTCCGCGGAGAGCCAACAAGAAATCATATTTTTATTTTATTAATCTACTACCGCTATATTAATCTACTACCGCTATATGCTAACTACCGCTATATGCTATTATTATTAAAATACCAAGAATTCAACTGACAA

Full Affymetrix probeset data:

Annotations for 1631564_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720