FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631566_at:

>probe:Drosophila_2:1631566_at:453:467; Interrogation_Position=1459; Antisense; GTTGTGTTGTATATCCTCTGCTATT
>probe:Drosophila_2:1631566_at:617:159; Interrogation_Position=1495; Antisense; ACAACAATGGTACTGTCTTCGCCTA
>probe:Drosophila_2:1631566_at:306:581; Interrogation_Position=1552; Antisense; TGGCGGAACAGCTCACGATCGCGTT
>probe:Drosophila_2:1631566_at:402:449; Interrogation_Position=1568; Antisense; GATCGCGTTCCTTTTGGTGGTCAAG
>probe:Drosophila_2:1631566_at:364:519; Interrogation_Position=1584; Antisense; GTGGTCAAGGTTCCCTTCAACGCAG
>probe:Drosophila_2:1631566_at:549:349; Interrogation_Position=1614; Antisense; GCAGTGACCTATGTCCTTGTCATAA
>probe:Drosophila_2:1631566_at:648:679; Interrogation_Position=1652; Antisense; TAGTGGAACTGTGCGCTCCTTCAAG
>probe:Drosophila_2:1631566_at:19:81; Interrogation_Position=1675; Antisense; AGGGACTTCAACCTTGGCTGCAGGA
>probe:Drosophila_2:1631566_at:446:559; Interrogation_Position=1697; Antisense; GGACAACACGAAGGGCACTCACACA
>probe:Drosophila_2:1631566_at:77:177; Interrogation_Position=1806; Antisense; AAACCCGCGGATTTCATGCACGAGC
>probe:Drosophila_2:1631566_at:729:541; Interrogation_Position=1836; Antisense; GGATTGCCGGATCCCGATGAAACCA
>probe:Drosophila_2:1631566_at:384:581; Interrogation_Position=1897; Antisense; TGGCCGCCTTTAACATGCTGGTTTA
>probe:Drosophila_2:1631566_at:9:53; Interrogation_Position=1911; Antisense; ATGCTGGTTTACCTATTCCCAATGC
>probe:Drosophila_2:1631566_at:207:251; Interrogation_Position=1930; Antisense; CAATGCCTAGATGTGTTCGCCAGAA

Paste this into a BLAST search page for me
GTTGTGTTGTATATCCTCTGCTATTACAACAATGGTACTGTCTTCGCCTATGGCGGAACAGCTCACGATCGCGTTGATCGCGTTCCTTTTGGTGGTCAAGGTGGTCAAGGTTCCCTTCAACGCAGGCAGTGACCTATGTCCTTGTCATAATAGTGGAACTGTGCGCTCCTTCAAGAGGGACTTCAACCTTGGCTGCAGGAGGACAACACGAAGGGCACTCACACAAAACCCGCGGATTTCATGCACGAGCGGATTGCCGGATCCCGATGAAACCATGGCCGCCTTTAACATGCTGGTTTAATGCTGGTTTACCTATTCCCAATGCCAATGCCTAGATGTGTTCGCCAGAA

Full Affymetrix probeset data:

Annotations for 1631566_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720