FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631570_at:

>probe:Drosophila_2:1631570_at:400:417; Interrogation_Position=131; Antisense; GAGCTCTTAGGGAATCCGGATTCGA
>probe:Drosophila_2:1631570_at:270:11; Interrogation_Position=150; Antisense; ATTCGATGAGGATTCTGCAGCTGGA
>probe:Drosophila_2:1631570_at:280:577; Interrogation_Position=189; Antisense; GGCGCTGTCCGGACTCAGTGGATTC
>probe:Drosophila_2:1631570_at:339:257; Interrogation_Position=227; Antisense; CAAAGGGCATTGGTGGCTCACTGCT
>probe:Drosophila_2:1631570_at:294:571; Interrogation_Position=241; Antisense; GGCTCACTGCTGTTCGATGTGGTCA
>probe:Drosophila_2:1631570_at:661:5; Interrogation_Position=280; Antisense; ATTGATTACATTACCAGTCTGCTGA
>probe:Drosophila_2:1631570_at:64:639; Interrogation_Position=356; Antisense; TCTGTTTCAACAGTCGCAGTGCCGA
>probe:Drosophila_2:1631570_at:461:105; Interrogation_Position=454; Antisense; AGACAGACTACCAGTGGCACGGGCA
>probe:Drosophila_2:1631570_at:178:141; Interrogation_Position=478; Antisense; ACGGGCTCTGTTACTGGCACTGGCA
>probe:Drosophila_2:1631570_at:57:651; Interrogation_Position=542; Antisense; TCACCTGCATTGTCCTGAGCAAGGA
>probe:Drosophila_2:1631570_at:397:557; Interrogation_Position=604; Antisense; GGAACGTTGAGATCTGTTTATCCTA
>probe:Drosophila_2:1631570_at:595:477; Interrogation_Position=619; Antisense; GTTTATCCTAAAAGCCATCGGCAGA
>probe:Drosophila_2:1631570_at:463:409; Interrogation_Position=642; Antisense; GACCCTGAAAAAGTACCGCCGGCAT
>probe:Drosophila_2:1631570_at:113:287; Interrogation_Position=94; Antisense; CTGGCTTTGCGTCCATTGACAGGAA

Paste this into a BLAST search page for me
GAGCTCTTAGGGAATCCGGATTCGAATTCGATGAGGATTCTGCAGCTGGAGGCGCTGTCCGGACTCAGTGGATTCCAAAGGGCATTGGTGGCTCACTGCTGGCTCACTGCTGTTCGATGTGGTCAATTGATTACATTACCAGTCTGCTGATCTGTTTCAACAGTCGCAGTGCCGAAGACAGACTACCAGTGGCACGGGCAACGGGCTCTGTTACTGGCACTGGCATCACCTGCATTGTCCTGAGCAAGGAGGAACGTTGAGATCTGTTTATCCTAGTTTATCCTAAAAGCCATCGGCAGAGACCCTGAAAAAGTACCGCCGGCATCTGGCTTTGCGTCCATTGACAGGAA

Full Affymetrix probeset data:

Annotations for 1631570_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720