FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631572_at:

>probe:Drosophila_2:1631572_at:615:275; Interrogation_Position=430; Antisense; CTTAAGTAGCTGATGGTGCCAACAC
>probe:Drosophila_2:1631572_at:679:459; Interrogation_Position=485; Antisense; GATTTCCTTATAACCAACAGCACTG
>probe:Drosophila_2:1631572_at:422:155; Interrogation_Position=501; Antisense; ACAGCACTGGTTGTGTGTTTAGCAT
>probe:Drosophila_2:1631572_at:590:161; Interrogation_Position=543; Antisense; AAATTTCCAGTATGTCTTCCGGTGA
>probe:Drosophila_2:1631572_at:313:25; Interrogation_Position=622; Antisense; ATAGGTTTCCCTAGAGTGCTCTTTA
>probe:Drosophila_2:1631572_at:25:89; Interrogation_Position=691; Antisense; AGTCGTATCGAAGTTGCCCAAAAGC
>probe:Drosophila_2:1631572_at:443:681; Interrogation_Position=762; Antisense; TATGATAGAAGCTATCCCCGCCAGG
>probe:Drosophila_2:1631572_at:95:679; Interrogation_Position=814; Antisense; TAGGTGCAACTGACCCATTTTGAAT
>probe:Drosophila_2:1631572_at:497:517; Interrogation_Position=839; Antisense; GTGGGAATAGTTGGTCCACTTCCAA
>probe:Drosophila_2:1631572_at:151:725; Interrogation_Position=872; Antisense; TTGTGCTTTCAACTGCCATTAACTG
>probe:Drosophila_2:1631572_at:467:315; Interrogation_Position=886; Antisense; GCCATTAACTGCACCCACGGGAGAA
>probe:Drosophila_2:1631572_at:376:79; Interrogation_Position=912; Antisense; AGGTGTCACGACCATCTTTTGATTT
>probe:Drosophila_2:1631572_at:89:691; Interrogation_Position=929; Antisense; TTTGATTTATTTAACGTCGCCTGAG
>probe:Drosophila_2:1631572_at:356:503; Interrogation_Position=944; Antisense; GTCGCCTGAGAGTTTTTTGTCATCA

Paste this into a BLAST search page for me
CTTAAGTAGCTGATGGTGCCAACACGATTTCCTTATAACCAACAGCACTGACAGCACTGGTTGTGTGTTTAGCATAAATTTCCAGTATGTCTTCCGGTGAATAGGTTTCCCTAGAGTGCTCTTTAAGTCGTATCGAAGTTGCCCAAAAGCTATGATAGAAGCTATCCCCGCCAGGTAGGTGCAACTGACCCATTTTGAATGTGGGAATAGTTGGTCCACTTCCAATTGTGCTTTCAACTGCCATTAACTGGCCATTAACTGCACCCACGGGAGAAAGGTGTCACGACCATCTTTTGATTTTTTGATTTATTTAACGTCGCCTGAGGTCGCCTGAGAGTTTTTTGTCATCA

Full Affymetrix probeset data:

Annotations for 1631572_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720