Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631573_a_at:

>probe:Drosophila_2:1631573_a_at:171:491; Interrogation_Position=1427; Antisense; GTCTCCGACTTGTTTCAAAAGCCCA
>probe:Drosophila_2:1631573_a_at:705:177; Interrogation_Position=1451; Antisense; AACACGAAGCCCTATTTGGCGCGTA
>probe:Drosophila_2:1631573_a_at:569:581; Interrogation_Position=1467; Antisense; TGGCGCGTACAGTGCAAGACATGAA
>probe:Drosophila_2:1631573_a_at:441:211; Interrogation_Position=1482; Antisense; AAGACATGAATGCATCGCCGGCCCA
>probe:Drosophila_2:1631573_a_at:258:577; Interrogation_Position=1501; Antisense; GGCCCAGGCCATAACGATTACTACA
>probe:Drosophila_2:1631573_a_at:661:249; Interrogation_Position=1558; Antisense; CAAGTTGCACGAGCTGTAGTTAAAC
>probe:Drosophila_2:1631573_a_at:644:73; Interrogation_Position=1585; Antisense; AGGACTCGATGTTCTTACGGCTTTC
>probe:Drosophila_2:1631573_a_at:123:73; Interrogation_Position=1621; Antisense; AGTGAAGCCTAGCTTTGCGAGCCTT
>probe:Drosophila_2:1631573_a_at:272:623; Interrogation_Position=1636; Antisense; TGCGAGCCTTCCCAATTAATTTATT
>probe:Drosophila_2:1631573_a_at:672:243; Interrogation_Position=1653; Antisense; AATTTATTCCTGTACTGGCATTTTA
>probe:Drosophila_2:1631573_a_at:501:513; Interrogation_Position=1698; Antisense; GTGTTAGCTGCAAGTGCACTCGAGT
>probe:Drosophila_2:1631573_a_at:347:355; Interrogation_Position=1713; Antisense; GCACTCGAGTGCCTTCTTTAATATT
>probe:Drosophila_2:1631573_a_at:477:657; Interrogation_Position=1792; Antisense; TAACTGACGCAACAATTTCCACAAA
>probe:Drosophila_2:1631573_a_at:493:511; Interrogation_Position=1821; Antisense; GTGACCTTTAAAACAGAGCTGCGCA

Paste this into a BLAST search page for me
GTCTCCGACTTGTTTCAAAAGCCCAAACACGAAGCCCTATTTGGCGCGTATGGCGCGTACAGTGCAAGACATGAAAAGACATGAATGCATCGCCGGCCCAGGCCCAGGCCATAACGATTACTACACAAGTTGCACGAGCTGTAGTTAAACAGGACTCGATGTTCTTACGGCTTTCAGTGAAGCCTAGCTTTGCGAGCCTTTGCGAGCCTTCCCAATTAATTTATTAATTTATTCCTGTACTGGCATTTTAGTGTTAGCTGCAAGTGCACTCGAGTGCACTCGAGTGCCTTCTTTAATATTTAACTGACGCAACAATTTCCACAAAGTGACCTTTAAAACAGAGCTGCGCA

Full Affymetrix probeset data:

Annotations for 1631573_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime