FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631575_at:

>probe:Drosophila_2:1631575_at:637:75; Interrogation_Position=431; Antisense; AGGAGCTGAGCGACTTAGAGCCCCT
>probe:Drosophila_2:1631575_at:24:305; Interrogation_Position=453; Antisense; CCTGGTCGGATTCACCAAGCTGGAA
>probe:Drosophila_2:1631575_at:286:585; Interrogation_Position=473; Antisense; TGGAAACCATCTGCCTGCTTATCAA
>probe:Drosophila_2:1631575_at:270:673; Interrogation_Position=520; Antisense; TACCGCGAGTACATGGCCTACAAGT
>probe:Drosophila_2:1631575_at:289:623; Interrogation_Position=554; Antisense; TGCGGCTACTCGACTTCAGGAAGAT
>probe:Drosophila_2:1631575_at:343:653; Interrogation_Position=578; Antisense; TCAAGCAGAAGGACCGCCAGGCGGC
>probe:Drosophila_2:1631575_at:304:93; Interrogation_Position=608; Antisense; AGTTCTTCCGCACCAAGCAGGGCAA
>probe:Drosophila_2:1631575_at:623:39; Interrogation_Position=720; Antisense; ATCGGAAGGCGGACGACTGGCCAAT
>probe:Drosophila_2:1631575_at:492:281; Interrogation_Position=789; Antisense; CTCTCTGGCAGAGGTGGAGCGTCTA
>probe:Drosophila_2:1631575_at:644:417; Interrogation_Position=805; Antisense; GAGCGTCTATCGCAGATCCTGCAAA
>probe:Drosophila_2:1631575_at:196:617; Interrogation_Position=824; Antisense; TGCAAAGCGGCCAGCTGCCGGATAA
>probe:Drosophila_2:1631575_at:116:319; Interrogation_Position=907; Antisense; GCCGTGGCCATGGAATACTAGGACT
>probe:Drosophila_2:1631575_at:624:675; Interrogation_Position=931; Antisense; TAGAATTATCCGCTCATCTGTCAGC
>probe:Drosophila_2:1631575_at:142:39; Interrogation_Position=946; Antisense; ATCTGTCAGCTACCTTATAACCGTA

Paste this into a BLAST search page for me
AGGAGCTGAGCGACTTAGAGCCCCTCCTGGTCGGATTCACCAAGCTGGAATGGAAACCATCTGCCTGCTTATCAATACCGCGAGTACATGGCCTACAAGTTGCGGCTACTCGACTTCAGGAAGATTCAAGCAGAAGGACCGCCAGGCGGCAGTTCTTCCGCACCAAGCAGGGCAAATCGGAAGGCGGACGACTGGCCAATCTCTCTGGCAGAGGTGGAGCGTCTAGAGCGTCTATCGCAGATCCTGCAAATGCAAAGCGGCCAGCTGCCGGATAAGCCGTGGCCATGGAATACTAGGACTTAGAATTATCCGCTCATCTGTCAGCATCTGTCAGCTACCTTATAACCGTA

Full Affymetrix probeset data:

Annotations for 1631575_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720