FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631576_at:

>probe:Drosophila_2:1631576_at:136:157; Interrogation_Position=1023; Antisense; ACACCTCAAGGTGCACGAGCGTTGA
>probe:Drosophila_2:1631576_at:76:531; Interrogation_Position=501; Antisense; GGGATTCCGGCAACTGAACAAGCTA
>probe:Drosophila_2:1631576_at:152:681; Interrogation_Position=573; Antisense; TATCTGCGGCAAGGGTTTCCGGTAT
>probe:Drosophila_2:1631576_at:409:483; Interrogation_Position=594; Antisense; GTATGCCAACTACCTAACTGTCCAT
>probe:Drosophila_2:1631576_at:563:595; Interrogation_Position=612; Antisense; TGTCCATCGACGCTTGCATACGGGA
>probe:Drosophila_2:1631576_at:415:391; Interrogation_Position=639; Antisense; GAAACCATATCCATGTTTGGCCACC
>probe:Drosophila_2:1631576_at:571:323; Interrogation_Position=694; Antisense; GCGCGGCGCATTCACACAAAGCTAA
>probe:Drosophila_2:1631576_at:726:111; Interrogation_Position=770; Antisense; AGCAACGGGATACATCTGCGCTCAG
>probe:Drosophila_2:1631576_at:607:535; Interrogation_Position=819; Antisense; GGTCCTAACGGATCAGTGCTATCTT
>probe:Drosophila_2:1631576_at:339:509; Interrogation_Position=834; Antisense; GTGCTATCTTAGCATCCACCTGAAG
>probe:Drosophila_2:1631576_at:330:207; Interrogation_Position=856; Antisense; AAGCGGCACTACAATCAGCGCGACT
>probe:Drosophila_2:1631576_at:474:95; Interrogation_Position=910; Antisense; AGATTCTTTAGTGCCTCGGAGCTGA
>probe:Drosophila_2:1631576_at:708:639; Interrogation_Position=925; Antisense; TCGGAGCTGAAGCACCACCAGATTG
>probe:Drosophila_2:1631576_at:633:597; Interrogation_Position=985; Antisense; TGTCCAGCACGATTTCTGCGCAAAT

Paste this into a BLAST search page for me
ACACCTCAAGGTGCACGAGCGTTGAGGGATTCCGGCAACTGAACAAGCTATATCTGCGGCAAGGGTTTCCGGTATGTATGCCAACTACCTAACTGTCCATTGTCCATCGACGCTTGCATACGGGAGAAACCATATCCATGTTTGGCCACCGCGCGGCGCATTCACACAAAGCTAAAGCAACGGGATACATCTGCGCTCAGGGTCCTAACGGATCAGTGCTATCTTGTGCTATCTTAGCATCCACCTGAAGAAGCGGCACTACAATCAGCGCGACTAGATTCTTTAGTGCCTCGGAGCTGATCGGAGCTGAAGCACCACCAGATTGTGTCCAGCACGATTTCTGCGCAAAT

Full Affymetrix probeset data:

Annotations for 1631576_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720