Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631577_a_at:

>probe:Drosophila_2:1631577_a_at:651:223; Interrogation_Position=1015; Antisense; AAGGTTCTATGCCAGCACATGCAGA
>probe:Drosophila_2:1631577_a_at:650:355; Interrogation_Position=1029; Antisense; GCACATGCAGATTTTCTAGGCTTTT
>probe:Drosophila_2:1631577_a_at:677:13; Interrogation_Position=1060; Antisense; ATATAAACCACCACTGCTACTCTTA
>probe:Drosophila_2:1631577_a_at:407:727; Interrogation_Position=580; Antisense; TTGTCCCAGCCGAGGAGGTAATGCA
>probe:Drosophila_2:1631577_a_at:518:77; Interrogation_Position=595; Antisense; AGGTAATGCAGATTCCGGTGCCCGT
>probe:Drosophila_2:1631577_a_at:207:173; Interrogation_Position=629; Antisense; AAAGCACTCGTCCAAGACCTACGTT
>probe:Drosophila_2:1631577_a_at:646:303; Interrogation_Position=742; Antisense; CCGACATCACCAATACCGAGTTTTT
>probe:Drosophila_2:1631577_a_at:105:695; Interrogation_Position=763; Antisense; TTTTCCCAACCTTAAGTGCGGCGCG
>probe:Drosophila_2:1631577_a_at:24:307; Interrogation_Position=822; Antisense; GCCTTCGAAGAAGTCCGTCACGGAA
>probe:Drosophila_2:1631577_a_at:606:377; Interrogation_Position=844; Antisense; GAAGCCGTTTCCAGCGTGTTCAGGA
>probe:Drosophila_2:1631577_a_at:259:409; Interrogation_Position=918; Antisense; GACGAAGCAAGCTAGGTCAGCCCAC
>probe:Drosophila_2:1631577_a_at:418:197; Interrogation_Position=946; Antisense; AACGGTGCTGTTGCTGGCCACTTGA
>probe:Drosophila_2:1631577_a_at:112:725; Interrogation_Position=967; Antisense; TTGAACCGCTATCTACCACAGTGTC
>probe:Drosophila_2:1631577_a_at:334:419; Interrogation_Position=999; Antisense; GAGCTCAAGCCATCCAAAGGTTCTA

Paste this into a BLAST search page for me
AAGGTTCTATGCCAGCACATGCAGAGCACATGCAGATTTTCTAGGCTTTTATATAAACCACCACTGCTACTCTTATTGTCCCAGCCGAGGAGGTAATGCAAGGTAATGCAGATTCCGGTGCCCGTAAAGCACTCGTCCAAGACCTACGTTCCGACATCACCAATACCGAGTTTTTTTTTCCCAACCTTAAGTGCGGCGCGGCCTTCGAAGAAGTCCGTCACGGAAGAAGCCGTTTCCAGCGTGTTCAGGAGACGAAGCAAGCTAGGTCAGCCCACAACGGTGCTGTTGCTGGCCACTTGATTGAACCGCTATCTACCACAGTGTCGAGCTCAAGCCATCCAAAGGTTCTA

Full Affymetrix probeset data:

Annotations for 1631577_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime