FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631581_at:

>probe:Drosophila_2:1631581_at:477:217; Interrogation_Position=1036; Antisense; AAGTCGTACGTGCATTTAGCTTTGC
>probe:Drosophila_2:1631581_at:710:385; Interrogation_Position=516; Antisense; GAACATGGGACTTACATTGCCGCGA
>probe:Drosophila_2:1631581_at:401:7; Interrogation_Position=531; Antisense; ATTGCCGCGAAGTGTTTTTGTTCCG
>probe:Drosophila_2:1631581_at:188:75; Interrogation_Position=599; Antisense; AGGACTTCCTTACGCGCTTGTGTAA
>probe:Drosophila_2:1631581_at:591:157; Interrogation_Position=673; Antisense; ACACAAGTGTTGTCCGAGAGTTCGG
>probe:Drosophila_2:1631581_at:724:383; Interrogation_Position=697; Antisense; GAACTTAATGGCAATCTTCGCCTGC
>probe:Drosophila_2:1631581_at:127:157; Interrogation_Position=727; Antisense; ACAGCCCCTATTATGAGTCACTCAG
>probe:Drosophila_2:1631581_at:691:647; Interrogation_Position=748; Antisense; TCAGATCAGCTGGACCCTATACAAA
>probe:Drosophila_2:1631581_at:632:365; Interrogation_Position=804; Antisense; GAATGCCCCAATCAAAGTACCCATT
>probe:Drosophila_2:1631581_at:527:169; Interrogation_Position=817; Antisense; AAAGTACCCATTTTCGTGGCCACTG
>probe:Drosophila_2:1631581_at:98:177; Interrogation_Position=863; Antisense; AAACGGAATCGTCGCAACTTTGCTT
>probe:Drosophila_2:1631581_at:554:277; Interrogation_Position=880; Antisense; CTTTGCTTCGTTAATATGGCTCTTA
>probe:Drosophila_2:1631581_at:551:309; Interrogation_Position=943; Antisense; GCCAACAGCTGTTCTCGGGAAATCG
>probe:Drosophila_2:1631581_at:349:411; Interrogation_Position=967; Antisense; GACGCCTTGGCGCTGAGCAAACATT

Paste this into a BLAST search page for me
AAGTCGTACGTGCATTTAGCTTTGCGAACATGGGACTTACATTGCCGCGAATTGCCGCGAAGTGTTTTTGTTCCGAGGACTTCCTTACGCGCTTGTGTAAACACAAGTGTTGTCCGAGAGTTCGGGAACTTAATGGCAATCTTCGCCTGCACAGCCCCTATTATGAGTCACTCAGTCAGATCAGCTGGACCCTATACAAAGAATGCCCCAATCAAAGTACCCATTAAAGTACCCATTTTCGTGGCCACTGAAACGGAATCGTCGCAACTTTGCTTCTTTGCTTCGTTAATATGGCTCTTAGCCAACAGCTGTTCTCGGGAAATCGGACGCCTTGGCGCTGAGCAAACATT

Full Affymetrix probeset data:

Annotations for 1631581_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720