Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631583_at:

>probe:Drosophila_2:1631583_at:155:29; Interrogation_Position=217; Antisense; ATACGCATTGTAATTTATGCCACAG
>probe:Drosophila_2:1631583_at:121:275; Interrogation_Position=222; Antisense; CATTGTAATTTATGCCACAGTACTC
>probe:Drosophila_2:1631583_at:218:255; Interrogation_Position=530; Antisense; CCTTCGTAATTCAGTATGTTTTAGT
>probe:Drosophila_2:1631583_at:269:91; Interrogation_Position=542; Antisense; AGTATGTTTTAGTCATATGCATTGA
>probe:Drosophila_2:1631583_at:351:39; Interrogation_Position=61; Antisense; ATCGTCGTGGTGAAACTGATAATTC
>probe:Drosophila_2:1631583_at:418:391; Interrogation_Position=72; Antisense; GAAACTGATAATTCTGTTCGAACAC
>probe:Drosophila_2:1631583_at:230:455; Interrogation_Position=78; Antisense; GATAATTCTGTTCGAACACATGCCT
>probe:Drosophila_2:1631583_at:185:247; Interrogation_Position=81; Antisense; AATTCTGTTCGAACACATGCCTTGC
>probe:Drosophila_2:1631583_at:160:701; Interrogation_Position=83; Antisense; TTCTGTTCGAACACATGCCTTGCTG
>probe:Drosophila_2:1631583_at:174:471; Interrogation_Position=87; Antisense; GTTCGAACACATGCCTTGCTGGGAT
>probe:Drosophila_2:1631583_at:333:297; Interrogation_Position=90; Antisense; CGAACACATGCCTTGCTGGGATTGT
>probe:Drosophila_2:1631583_at:11:159; Interrogation_Position=93; Antisense; ACACATGCCTTGCTGGGATTGTTTG
>probe:Drosophila_2:1631583_at:3:51; Interrogation_Position=97; Antisense; ATGCCTTGCTGGGATTGTTTGTTCA
>probe:Drosophila_2:1631583_at:397:315; Interrogation_Position=99; Antisense; GCCTTGCTGGGATTGTTTGTTCAGG

Paste this into a BLAST search page for me
ATACGCATTGTAATTTATGCCACAGCATTGTAATTTATGCCACAGTACTCCCTTCGTAATTCAGTATGTTTTAGTAGTATGTTTTAGTCATATGCATTGAATCGTCGTGGTGAAACTGATAATTCGAAACTGATAATTCTGTTCGAACACGATAATTCTGTTCGAACACATGCCTAATTCTGTTCGAACACATGCCTTGCTTCTGTTCGAACACATGCCTTGCTGGTTCGAACACATGCCTTGCTGGGATCGAACACATGCCTTGCTGGGATTGTACACATGCCTTGCTGGGATTGTTTGATGCCTTGCTGGGATTGTTTGTTCAGCCTTGCTGGGATTGTTTGTTCAGG

Full Affymetrix probeset data:

Annotations for 1631583_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime