FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631588_at:

>probe:Drosophila_2:1631588_at:688:517; Interrogation_Position=1327; Antisense; GTGGAGACTTAATTACGGCGGCATT
>probe:Drosophila_2:1631588_at:632:13; Interrogation_Position=1338; Antisense; ATTACGGCGGCATTGCGCTGATGTG
>probe:Drosophila_2:1631588_at:668:45; Interrogation_Position=1379; Antisense; ATCCGCAGCGTCTTTCTGGGCAACA
>probe:Drosophila_2:1631588_at:393:657; Interrogation_Position=1405; Antisense; TAAGGACGCGTATACGTCGCAGCCG
>probe:Drosophila_2:1631588_at:616:125; Interrogation_Position=1425; Antisense; AGCCGGAGCTGTCTAATCTGCTGCT
>probe:Drosophila_2:1631588_at:308:435; Interrogation_Position=1499; Antisense; GAGGTGGTGGCCAATGCCTTCCGCT
>probe:Drosophila_2:1631588_at:324:659; Interrogation_Position=1557; Antisense; TAAGCTTCTACGACGGCTACCGCAC
>probe:Drosophila_2:1631588_at:252:255; Interrogation_Position=1597; Antisense; CAACTTGCTGCAGGCCCAGAGGGAT
>probe:Drosophila_2:1631588_at:196:101; Interrogation_Position=1614; Antisense; AGAGGGATTACTTCGGCGCCCACAC
>probe:Drosophila_2:1631588_at:260:157; Interrogation_Position=1635; Antisense; ACACCTATGAGCTGCTGGGCCAGGA
>probe:Drosophila_2:1631588_at:13:77; Interrogation_Position=1656; Antisense; AGGAGGGTCAGTTCCACCACACGAA
>probe:Drosophila_2:1631588_at:617:135; Interrogation_Position=1676; Antisense; ACGAACTGGACAGGCACCGGCGGCA
>probe:Drosophila_2:1631588_at:521:473; Interrogation_Position=1752; Antisense; GTTCACACATTCCATGTCATTGGCG
>probe:Drosophila_2:1631588_at:492:3; Interrogation_Position=1770; Antisense; ATTGGCGCCGGTGTCTTAGATGTTT

Paste this into a BLAST search page for me
GTGGAGACTTAATTACGGCGGCATTATTACGGCGGCATTGCGCTGATGTGATCCGCAGCGTCTTTCTGGGCAACATAAGGACGCGTATACGTCGCAGCCGAGCCGGAGCTGTCTAATCTGCTGCTGAGGTGGTGGCCAATGCCTTCCGCTTAAGCTTCTACGACGGCTACCGCACCAACTTGCTGCAGGCCCAGAGGGATAGAGGGATTACTTCGGCGCCCACACACACCTATGAGCTGCTGGGCCAGGAAGGAGGGTCAGTTCCACCACACGAAACGAACTGGACAGGCACCGGCGGCAGTTCACACATTCCATGTCATTGGCGATTGGCGCCGGTGTCTTAGATGTTT

Full Affymetrix probeset data:

Annotations for 1631588_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720