Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631591_at:

>probe:Drosophila_2:1631591_at:111:93; Interrogation_Position=2226; Antisense; AGTTCTTCACTATTTGGAGACACGA
>probe:Drosophila_2:1631591_at:117:495; Interrogation_Position=2278; Antisense; GTAATTCCACTACTGCATTCAGCAA
>probe:Drosophila_2:1631591_at:695:459; Interrogation_Position=2344; Antisense; GATTTGTTCAGTTCCCAGATCGAGA
>probe:Drosophila_2:1631591_at:605:635; Interrogation_Position=2363; Antisense; TCGAGAAGCTTCTCAGCGATCTCTG
>probe:Drosophila_2:1631591_at:199:449; Interrogation_Position=2399; Antisense; GATCCCATTCGGATGAACTTCCGTC
>probe:Drosophila_2:1631591_at:36:663; Interrogation_Position=2426; Antisense; TAAAACCCTTATTGGATGACCTGGC
>probe:Drosophila_2:1631591_at:570:407; Interrogation_Position=2462; Antisense; GACGGTTCTACCAGTTCAAGTGTTT
>probe:Drosophila_2:1631591_at:712:377; Interrogation_Position=2513; Antisense; GAAGCTCTCTTCAGCAAGTGAAACT
>probe:Drosophila_2:1631591_at:420:437; Interrogation_Position=2545; Antisense; GAGGAGATCCTTCGCAATGACAACT
>probe:Drosophila_2:1631591_at:35:165; Interrogation_Position=2583; Antisense; AAATCGACGACTGACTGCAGCTGGC
>probe:Drosophila_2:1631591_at:137:333; Interrogation_Position=2602; Antisense; GCTGGCGATGGCACTTTGTATGACA
>probe:Drosophila_2:1631591_at:179:549; Interrogation_Position=2646; Antisense; GGAGGACATGGCTGACCGACTGATA
>probe:Drosophila_2:1631591_at:266:531; Interrogation_Position=2721; Antisense; GGGTCTATATTTGGGCCCACAGTTC
>probe:Drosophila_2:1631591_at:479:281; Interrogation_Position=2736; Antisense; CCCACAGTTCATGAGGGCCATTGTA

Paste this into a BLAST search page for me
AGTTCTTCACTATTTGGAGACACGAGTAATTCCACTACTGCATTCAGCAAGATTTGTTCAGTTCCCAGATCGAGATCGAGAAGCTTCTCAGCGATCTCTGGATCCCATTCGGATGAACTTCCGTCTAAAACCCTTATTGGATGACCTGGCGACGGTTCTACCAGTTCAAGTGTTTGAAGCTCTCTTCAGCAAGTGAAACTGAGGAGATCCTTCGCAATGACAACTAAATCGACGACTGACTGCAGCTGGCGCTGGCGATGGCACTTTGTATGACAGGAGGACATGGCTGACCGACTGATAGGGTCTATATTTGGGCCCACAGTTCCCCACAGTTCATGAGGGCCATTGTA

Full Affymetrix probeset data:

Annotations for 1631591_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime