Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631593_at:

>probe:Drosophila_2:1631593_at:332:551; Interrogation_Position=114; Antisense; GGAGTTGAAGGCATCCCACCAGTAT
>probe:Drosophila_2:1631593_at:348:19; Interrogation_Position=155; Antisense; ATTTCGATCGCTCCGATATCAGTTC
>probe:Drosophila_2:1631593_at:284:457; Interrogation_Position=169; Antisense; GATATCAGTTCACCCGGAATGCATC
>probe:Drosophila_2:1631593_at:74:233; Interrogation_Position=186; Antisense; AATGCATCGATTCTTCCTAAAGGCG
>probe:Drosophila_2:1631593_at:257:385; Interrogation_Position=255; Antisense; GAACAAGCGTGGTGGTCTAATCATT
>probe:Drosophila_2:1631593_at:265:703; Interrogation_Position=278; Antisense; TTTTGAGCAGTGTACCACAGCCGTT
>probe:Drosophila_2:1631593_at:85:633; Interrogation_Position=311; Antisense; TCGCCAGCACCTTGGATGCACTAAA
>probe:Drosophila_2:1631593_at:288:379; Interrogation_Position=403; Antisense; GAAGCGGATCCGAATCTCTGCGATT
>probe:Drosophila_2:1631593_at:276:39; Interrogation_Position=416; Antisense; ATCTCTGCGATTTCATCGAGGCCAA
>probe:Drosophila_2:1631593_at:64:259; Interrogation_Position=43; Antisense; CACATGTGCATGCTGGTGCGTCAGA
>probe:Drosophila_2:1631593_at:656:637; Interrogation_Position=431; Antisense; TCGAGGCCAATTTCCTGCAGGAGCA
>probe:Drosophila_2:1631593_at:365:77; Interrogation_Position=515; Antisense; AGGTGGGCGAATTCCTGTTCGACAA
>probe:Drosophila_2:1631593_at:481:263; Interrogation_Position=549; Antisense; CAGCGGCATGCATCCTGCGAAATGA
>probe:Drosophila_2:1631593_at:570:535; Interrogation_Position=57; Antisense; GGTGCGTCAGAACTTCGCCAAAAGT

Paste this into a BLAST search page for me
GGAGTTGAAGGCATCCCACCAGTATATTTCGATCGCTCCGATATCAGTTCGATATCAGTTCACCCGGAATGCATCAATGCATCGATTCTTCCTAAAGGCGGAACAAGCGTGGTGGTCTAATCATTTTTTGAGCAGTGTACCACAGCCGTTTCGCCAGCACCTTGGATGCACTAAAGAAGCGGATCCGAATCTCTGCGATTATCTCTGCGATTTCATCGAGGCCAACACATGTGCATGCTGGTGCGTCAGATCGAGGCCAATTTCCTGCAGGAGCAAGGTGGGCGAATTCCTGTTCGACAACAGCGGCATGCATCCTGCGAAATGAGGTGCGTCAGAACTTCGCCAAAAGT

Full Affymetrix probeset data:

Annotations for 1631593_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime