Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631597_at:

>probe:Drosophila_2:1631597_at:489:303; Interrogation_Position=3086; Antisense; CCGCAGCTGGTTGGGAAACTGGAAA
>probe:Drosophila_2:1631597_at:649:289; Interrogation_Position=3119; Antisense; CGGATGCGGAGTCGATGTCTTTATC
>probe:Drosophila_2:1631597_at:177:645; Interrogation_Position=3136; Antisense; TCTTTATCGGGTATGCAGCAGCTGC
>probe:Drosophila_2:1631597_at:210:353; Interrogation_Position=3153; Antisense; GCAGCTGCAGGATCAGTGAGCCGAA
>probe:Drosophila_2:1631597_at:661:319; Interrogation_Position=3185; Antisense; GCCGCAGCTGGACCGTCACTAAAAA
>probe:Drosophila_2:1631597_at:76:457; Interrogation_Position=3219; Antisense; GATAAATCTGGTCGCTTCTAATCTA
>probe:Drosophila_2:1631597_at:430:591; Interrogation_Position=3227; Antisense; TGGTCGCTTCTAATCTAACATACAT
>probe:Drosophila_2:1631597_at:557:343; Interrogation_Position=3299; Antisense; GCATTACACATAGAAACGAAGCATA
>probe:Drosophila_2:1631597_at:631:247; Interrogation_Position=3361; Antisense; CAATTTGTGAAATTCTCTGAGTGGC
>probe:Drosophila_2:1631597_at:237:335; Interrogation_Position=3391; Antisense; GCTGAGAAAACATCTTTGGCCACCA
>probe:Drosophila_2:1631597_at:421:691; Interrogation_Position=3405; Antisense; TTTGGCCACCAATGAAGGGAAATTT
>probe:Drosophila_2:1631597_at:661:475; Interrogation_Position=3454; Antisense; GTTATTAGGTTCAACTTTGTACATA
>probe:Drosophila_2:1631597_at:445:659; Interrogation_Position=3489; Antisense; TAACCTTGACGTAATGAAACCCACA
>probe:Drosophila_2:1631597_at:588:619; Interrogation_Position=3602; Antisense; TGCTAGCCAGCAGTCATCGAGGAAA

Paste this into a BLAST search page for me
CCGCAGCTGGTTGGGAAACTGGAAACGGATGCGGAGTCGATGTCTTTATCTCTTTATCGGGTATGCAGCAGCTGCGCAGCTGCAGGATCAGTGAGCCGAAGCCGCAGCTGGACCGTCACTAAAAAGATAAATCTGGTCGCTTCTAATCTATGGTCGCTTCTAATCTAACATACATGCATTACACATAGAAACGAAGCATACAATTTGTGAAATTCTCTGAGTGGCGCTGAGAAAACATCTTTGGCCACCATTTGGCCACCAATGAAGGGAAATTTGTTATTAGGTTCAACTTTGTACATATAACCTTGACGTAATGAAACCCACATGCTAGCCAGCAGTCATCGAGGAAA

Full Affymetrix probeset data:

Annotations for 1631597_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime