FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631598_at:

>probe:Drosophila_2:1631598_at:50:557; Interrogation_Position=1032; Antisense; GGACGATGCGTCCTTGACCATGGCC
>probe:Drosophila_2:1631598_at:226:257; Interrogation_Position=1056; Antisense; CACTTGCTCCTTTTATGATCACACG
>probe:Drosophila_2:1631598_at:604:129; Interrogation_Position=604; Antisense; ACCTGTGCCTTTGATCGTTGGTCAC
>probe:Drosophila_2:1631598_at:326:495; Interrogation_Position=624; Antisense; GTCACCGCACATTCTGTACAGTGGT
>probe:Drosophila_2:1631598_at:437:325; Interrogation_Position=650; Antisense; GCGACGATATGCTGCTCATGGCCCA
>probe:Drosophila_2:1631598_at:527:201; Interrogation_Position=706; Antisense; AACCGGGCGCACATGGCTGGAGTCA
>probe:Drosophila_2:1631598_at:75:587; Interrogation_Position=723; Antisense; TGGAGTCACCTGTCTGCTAAGTCAT
>probe:Drosophila_2:1631598_at:304:183; Interrogation_Position=758; Antisense; AAAACCATCTGCTCACGGGTAGCTA
>probe:Drosophila_2:1631598_at:103:607; Interrogation_Position=783; Antisense; TGATGAGCAGTTGCGTCTCTTCGAC
>probe:Drosophila_2:1631598_at:216:379; Interrogation_Position=819; Antisense; GAAGCGATCACTGGCGGAACTGGAC
>probe:Drosophila_2:1631598_at:634:381; Interrogation_Position=835; Antisense; GAACTGGACTTGAGCGGAGGCATCT
>probe:Drosophila_2:1631598_at:165:255; Interrogation_Position=918; Antisense; CAACTTTAGCGTGGTGCAGCTGGAT
>probe:Drosophila_2:1631598_at:164:287; Interrogation_Position=947; Antisense; CGGCACCTGGCCTGAGTTTACTGGG
>probe:Drosophila_2:1631598_at:159:699; Interrogation_Position=963; Antisense; TTTACTGGGCGCCTATGAGGAGCAT

Paste this into a BLAST search page for me
GGACGATGCGTCCTTGACCATGGCCCACTTGCTCCTTTTATGATCACACGACCTGTGCCTTTGATCGTTGGTCACGTCACCGCACATTCTGTACAGTGGTGCGACGATATGCTGCTCATGGCCCAAACCGGGCGCACATGGCTGGAGTCATGGAGTCACCTGTCTGCTAAGTCATAAAACCATCTGCTCACGGGTAGCTATGATGAGCAGTTGCGTCTCTTCGACGAAGCGATCACTGGCGGAACTGGACGAACTGGACTTGAGCGGAGGCATCTCAACTTTAGCGTGGTGCAGCTGGATCGGCACCTGGCCTGAGTTTACTGGGTTTACTGGGCGCCTATGAGGAGCAT

Full Affymetrix probeset data:

Annotations for 1631598_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720