FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631602_at:

>probe:Drosophila_2:1631602_at:567:577; Interrogation_Position=196; Antisense; GGCCACTATGCGCACAACTTGAAGG
>probe:Drosophila_2:1631602_at:151:259; Interrogation_Position=254; Antisense; CACGATCCATGGACTGGCGCGAGGA
>probe:Drosophila_2:1631602_at:134:77; Interrogation_Position=275; Antisense; AGGAGTACGCGCAGTTCGTCAAGCG
>probe:Drosophila_2:1631602_at:345:427; Interrogation_Position=319; Antisense; GAGATCTACAAGCTCTTCTTCGTGA
>probe:Drosophila_2:1631602_at:24:501; Interrogation_Position=352; Antisense; GTCGACTACTTCCTCATCAGGGAAT
>probe:Drosophila_2:1631602_at:411:555; Interrogation_Position=384; Antisense; GGACCTGCTGAAAACCACCTATATG
>probe:Drosophila_2:1631602_at:168:687; Interrogation_Position=403; Antisense; TATATGTCGGACTACTCGCCCAAAG
>probe:Drosophila_2:1631602_at:355:127; Interrogation_Position=445; Antisense; AGCCAGCGCGAGCATAGGGTCCAAC
>probe:Drosophila_2:1631602_at:148:193; Interrogation_Position=467; Antisense; AACTCGACGGCTCGGACGGCATTGA
>probe:Drosophila_2:1631602_at:509:139; Interrogation_Position=482; Antisense; ACGGCATTGACTATCGGACGACCTA
>probe:Drosophila_2:1631602_at:514:409; Interrogation_Position=498; Antisense; GACGACCTATGGCAACTATCACAAT
>probe:Drosophila_2:1631602_at:253:203; Interrogation_Position=566; Antisense; AACCAGGATCGATTGTCAGGAGCAT
>probe:Drosophila_2:1631602_at:489:623; Interrogation_Position=617; Antisense; TGCGCAAGCTGTTCACTAAGTACAA
>probe:Drosophila_2:1631602_at:406:489; Interrogation_Position=636; Antisense; GTACAATCTAACCACCTACTACGAG

Paste this into a BLAST search page for me
GGCCACTATGCGCACAACTTGAAGGCACGATCCATGGACTGGCGCGAGGAAGGAGTACGCGCAGTTCGTCAAGCGGAGATCTACAAGCTCTTCTTCGTGAGTCGACTACTTCCTCATCAGGGAATGGACCTGCTGAAAACCACCTATATGTATATGTCGGACTACTCGCCCAAAGAGCCAGCGCGAGCATAGGGTCCAACAACTCGACGGCTCGGACGGCATTGAACGGCATTGACTATCGGACGACCTAGACGACCTATGGCAACTATCACAATAACCAGGATCGATTGTCAGGAGCATTGCGCAAGCTGTTCACTAAGTACAAGTACAATCTAACCACCTACTACGAG

Full Affymetrix probeset data:

Annotations for 1631602_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720