FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631603_at:

>probe:Drosophila_2:1631603_at:507:373; Interrogation_Position=124; Antisense; GAAGTTCGCCACCACGGAACAACAA
>probe:Drosophila_2:1631603_at:346:561; Interrogation_Position=139; Antisense; GGAACAACAATTCTGCAAGGCGCGC
>probe:Drosophila_2:1631603_at:511:361; Interrogation_Position=153; Antisense; GCAAGGCGCGCAACGAAGCGACTTT
>probe:Drosophila_2:1631603_at:103:377; Interrogation_Position=167; Antisense; GAAGCGACTTTCCTGGGTCAAACCT
>probe:Drosophila_2:1631603_at:421:525; Interrogation_Position=182; Antisense; GGTCAAACCTACCTGACCTACCTAG
>probe:Drosophila_2:1631603_at:33:527; Interrogation_Position=19; Antisense; GGGAACCAAGGTGCTGCGCTCCCTG
>probe:Drosophila_2:1631603_at:139:123; Interrogation_Position=213; Antisense; AGCGCCGGTACTTGGAGCTCTACAA
>probe:Drosophila_2:1631603_at:66:553; Interrogation_Position=226; Antisense; GGAGCTCTACAAGGAATATCACGGA
>probe:Drosophila_2:1631603_at:102:43; Interrogation_Position=261; Antisense; GATCCGTAAGGGATACCGCCGATTT
>probe:Drosophila_2:1631603_at:645:517; Interrogation_Position=287; Antisense; GTGGGCTTCAAGCTGCCCTCGGATC
>probe:Drosophila_2:1631603_at:165:621; Interrogation_Position=42; Antisense; TGCTGCACGAATTGCGCCAGGCATC
>probe:Drosophila_2:1631603_at:147:73; Interrogation_Position=60; Antisense; AGGCATCTCCAAATGGCTGCATCAA
>probe:Drosophila_2:1631603_at:288:619; Interrogation_Position=77; Antisense; TGCATCAAGGACTCTCTGGCCGCGC
>probe:Drosophila_2:1631603_at:420:577; Interrogation_Position=94; Antisense; GGCCGCGCGCTACATTTTGGCGCAA

Paste this into a BLAST search page for me
GAAGTTCGCCACCACGGAACAACAAGGAACAACAATTCTGCAAGGCGCGCGCAAGGCGCGCAACGAAGCGACTTTGAAGCGACTTTCCTGGGTCAAACCTGGTCAAACCTACCTGACCTACCTAGGGGAACCAAGGTGCTGCGCTCCCTGAGCGCCGGTACTTGGAGCTCTACAAGGAGCTCTACAAGGAATATCACGGAGATCCGTAAGGGATACCGCCGATTTGTGGGCTTCAAGCTGCCCTCGGATCTGCTGCACGAATTGCGCCAGGCATCAGGCATCTCCAAATGGCTGCATCAATGCATCAAGGACTCTCTGGCCGCGCGGCCGCGCGCTACATTTTGGCGCAA

Full Affymetrix probeset data:

Annotations for 1631603_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720