Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631604_at:

>probe:Drosophila_2:1631604_at:116:221; Interrogation_Position=1030; Antisense; AAGGGACTGGACCTGTTCGTCATCT
>probe:Drosophila_2:1631604_at:243:471; Interrogation_Position=1044; Antisense; GTTCGTCATCTTTCTTTTTAGCAAT
>probe:Drosophila_2:1631604_at:325:363; Interrogation_Position=1072; Antisense; GAATTCCTAGACCTGGTGCACGAGC
>probe:Drosophila_2:1631604_at:341:113; Interrogation_Position=1094; Antisense; AGCACTGGGAGCAGCTGTTGCCACA
>probe:Drosophila_2:1631604_at:629:495; Interrogation_Position=1119; Antisense; GTCACCCAGTTTGCTATACGACGAG
>probe:Drosophila_2:1631604_at:652:259; Interrogation_Position=1148; Antisense; CACGCCAATTGTACGATCTGCAGCA
>probe:Drosophila_2:1631604_at:517:263; Interrogation_Position=1168; Antisense; CAGCAGCTGTATCAGGTCTTCAAGC
>probe:Drosophila_2:1631604_at:393:331; Interrogation_Position=1309; Antisense; GCGGCACAAAGCGTCGGCACGGTTA
>probe:Drosophila_2:1631604_at:673:705; Interrogation_Position=1331; Antisense; TTACCTTCAACATGATCCGGGCCAA
>probe:Drosophila_2:1631604_at:386:43; Interrogation_Position=814; Antisense; ATCGACGGTGACCATGCTGATCTGG
>probe:Drosophila_2:1631604_at:325:587; Interrogation_Position=878; Antisense; TGGACGTCATGCTTGCCACGGAGGA
>probe:Drosophila_2:1631604_at:598:513; Interrogation_Position=925; Antisense; GTGTATGCGTACCTGGAGCACCACT
>probe:Drosophila_2:1631604_at:316:259; Interrogation_Position=946; Antisense; CACTTGCGCACCGATTACGAGGAGA
>probe:Drosophila_2:1631604_at:680:527; Interrogation_Position=974; Antisense; GGGACACATCGAGCAGCGAGCACAT

Paste this into a BLAST search page for me
AAGGGACTGGACCTGTTCGTCATCTGTTCGTCATCTTTCTTTTTAGCAATGAATTCCTAGACCTGGTGCACGAGCAGCACTGGGAGCAGCTGTTGCCACAGTCACCCAGTTTGCTATACGACGAGCACGCCAATTGTACGATCTGCAGCACAGCAGCTGTATCAGGTCTTCAAGCGCGGCACAAAGCGTCGGCACGGTTATTACCTTCAACATGATCCGGGCCAAATCGACGGTGACCATGCTGATCTGGTGGACGTCATGCTTGCCACGGAGGAGTGTATGCGTACCTGGAGCACCACTCACTTGCGCACCGATTACGAGGAGAGGGACACATCGAGCAGCGAGCACAT

Full Affymetrix probeset data:

Annotations for 1631604_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime