FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631610_at:

>probe:Drosophila_2:1631610_at:323:687; Interrogation_Position=2108; Antisense; TATACGCCATCTTTCCCATTACGGT
>probe:Drosophila_2:1631610_at:366:141; Interrogation_Position=2128; Antisense; ACGGTGCTGGTGCTGATCCTTTGCT
>probe:Drosophila_2:1631610_at:15:47; Interrogation_Position=2143; Antisense; ATCCTTTGCTGCTCCTTCCTGTAGT
>probe:Drosophila_2:1631610_at:307:485; Interrogation_Position=2163; Antisense; GTAGTCCTCCTGATCCAATATTATT
>probe:Drosophila_2:1631610_at:338:279; Interrogation_Position=2220; Antisense; CTACCGGGTGATATACTCGCTTGTG
>probe:Drosophila_2:1631610_at:509:279; Interrogation_Position=2235; Antisense; CTCGCTTGTGAGTGTGTTAACGTTA
>probe:Drosophila_2:1631610_at:652:593; Interrogation_Position=2247; Antisense; TGTGTTAACGTTATGGCCGGCCCCA
>probe:Drosophila_2:1631610_at:213:581; Interrogation_Position=2260; Antisense; TGGCCGGCCCCAAAACGAGAGCTTT
>probe:Drosophila_2:1631610_at:638:7; Interrogation_Position=2302; Antisense; ATTCCATATCGGTTATACACACACG
>probe:Drosophila_2:1631610_at:133:665; Interrogation_Position=2317; Antisense; TACACACACGGAATGAACAGTCTGA
>probe:Drosophila_2:1631610_at:716:109; Interrogation_Position=2381; Antisense; AGAATGTAGCCTAAGACGCAAGCAT
>probe:Drosophila_2:1631610_at:468:409; Interrogation_Position=2395; Antisense; GACGCAAGCATTTTTTGGTCTACAA
>probe:Drosophila_2:1631610_at:353:403; Interrogation_Position=2551; Antisense; GACTTTGATCTTTTTGTTTACCTGA
>probe:Drosophila_2:1631610_at:378:477; Interrogation_Position=2621; Antisense; GTTTTAATGCTTTTGTTGACTTTGT

Paste this into a BLAST search page for me
TATACGCCATCTTTCCCATTACGGTACGGTGCTGGTGCTGATCCTTTGCTATCCTTTGCTGCTCCTTCCTGTAGTGTAGTCCTCCTGATCCAATATTATTCTACCGGGTGATATACTCGCTTGTGCTCGCTTGTGAGTGTGTTAACGTTATGTGTTAACGTTATGGCCGGCCCCATGGCCGGCCCCAAAACGAGAGCTTTATTCCATATCGGTTATACACACACGTACACACACGGAATGAACAGTCTGAAGAATGTAGCCTAAGACGCAAGCATGACGCAAGCATTTTTTGGTCTACAAGACTTTGATCTTTTTGTTTACCTGAGTTTTAATGCTTTTGTTGACTTTGT

Full Affymetrix probeset data:

Annotations for 1631610_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720