FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631611_at:

>probe:Drosophila_2:1631611_at:156:9; Interrogation_Position=226; Antisense; ATTGCGGCCAATGTGTCATGTTTCC
>probe:Drosophila_2:1631611_at:115:435; Interrogation_Position=301; Antisense; GAGGAGGAAATACCCGCGACACCAA
>probe:Drosophila_2:1631611_at:142:587; Interrogation_Position=345; Antisense; TGTGGAGACCCCAACCGAAGTGGAT
>probe:Drosophila_2:1631611_at:297:685; Interrogation_Position=369; Antisense; TATCATAAATATTGCGCCCGTTGTA
>probe:Drosophila_2:1631611_at:400:721; Interrogation_Position=389; Antisense; TTGTAAGGCCCAACTGTCCGATCAG
>probe:Drosophila_2:1631611_at:305:443; Interrogation_Position=415; Antisense; GATGATCCCGGCCAGGTTATATTCA
>probe:Drosophila_2:1631611_at:142:311; Interrogation_Position=461; Antisense; CCAACTATTATCTCTGCTATCACGG
>probe:Drosophila_2:1631611_at:299:607; Interrogation_Position=513; Antisense; TGAGCTGTACTTTAATTCCCTCACC
>probe:Drosophila_2:1631611_at:623:127; Interrogation_Position=535; Antisense; ACCGGACAGTGCGATTACCCAGATA
>probe:Drosophila_2:1631611_at:245:93; Interrogation_Position=561; Antisense; AGTTCAGTGTGCCTTCGAAGATCCG
>probe:Drosophila_2:1631611_at:89:159; Interrogation_Position=606; Antisense; ACACATGACCGAGTTCTTTCCACAT
>probe:Drosophila_2:1631611_at:526:147; Interrogation_Position=653; Antisense; ACTACTGCATCAAGGGCTTTCTGAC
>probe:Drosophila_2:1631611_at:319:107; Interrogation_Position=714; Antisense; AGAACGCCGGAGTTGTGTGCAGATA
>probe:Drosophila_2:1631611_at:119:221; Interrogation_Position=770; Antisense; GAATAGGTCGGAAAGCCCCATTGCC

Paste this into a BLAST search page for me
ATTGCGGCCAATGTGTCATGTTTCCGAGGAGGAAATACCCGCGACACCAATGTGGAGACCCCAACCGAAGTGGATTATCATAAATATTGCGCCCGTTGTATTGTAAGGCCCAACTGTCCGATCAGGATGATCCCGGCCAGGTTATATTCACCAACTATTATCTCTGCTATCACGGTGAGCTGTACTTTAATTCCCTCACCACCGGACAGTGCGATTACCCAGATAAGTTCAGTGTGCCTTCGAAGATCCGACACATGACCGAGTTCTTTCCACATACTACTGCATCAAGGGCTTTCTGACAGAACGCCGGAGTTGTGTGCAGATAGAATAGGTCGGAAAGCCCCATTGCC

Full Affymetrix probeset data:

Annotations for 1631611_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720