Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631612_at:

>probe:Drosophila_2:1631612_at:80:233; Interrogation_Position=2040; Antisense; CAATAATGAGCGACGTTGACCGATT
>probe:Drosophila_2:1631612_at:596:1; Interrogation_Position=2045; Antisense; ATGAGCGACGTTGACCGATTTCGGT
>probe:Drosophila_2:1631612_at:123:101; Interrogation_Position=2049; Antisense; GCGACGTTGACCGATTTCGGTACCG
>probe:Drosophila_2:1631612_at:572:715; Interrogation_Position=2064; Antisense; TTCGGTACCGACAATGTAACGACAT
>probe:Drosophila_2:1631612_at:91:161; Interrogation_Position=2074; Antisense; ACAATGTAACGACATCTTGGCCCCT
>probe:Drosophila_2:1631612_at:28:601; Interrogation_Position=2078; Antisense; TGTAACGACATCTTGGCCCCTGGAA
>probe:Drosophila_2:1631612_at:279:271; Interrogation_Position=2086; Antisense; CATCTTGGCCCCTGGAACAAATTTT
>probe:Drosophila_2:1631612_at:102:403; Interrogation_Position=2147; Antisense; GACATTCATTAAGAATTTTGCGTAC
>probe:Drosophila_2:1631612_at:345:209; Interrogation_Position=2157; Antisense; AAGAATTTTGCGTACATCGAAACTA
>probe:Drosophila_2:1631612_at:546:143; Interrogation_Position=2160; Antisense; AATTTTGCGTACATCGAAACTATTC
>probe:Drosophila_2:1631612_at:557:145; Interrogation_Position=2178; Antisense; ACTATTCAATAACCTTTTACGCTCA
>probe:Drosophila_2:1631612_at:348:653; Interrogation_Position=2183; Antisense; TCAATAACCTTTTACGCTCACTTTT
>probe:Drosophila_2:1631612_at:118:259; Interrogation_Position=2201; Antisense; CACTTTTCTTATTTATACCCTATAG
>probe:Drosophila_2:1631612_at:251:277; Interrogation_Position=2208; Antisense; CTTATTTATACCCTATAGTTAGATA

Paste this into a BLAST search page for me
CAATAATGAGCGACGTTGACCGATTATGAGCGACGTTGACCGATTTCGGTGCGACGTTGACCGATTTCGGTACCGTTCGGTACCGACAATGTAACGACATACAATGTAACGACATCTTGGCCCCTTGTAACGACATCTTGGCCCCTGGAACATCTTGGCCCCTGGAACAAATTTTGACATTCATTAAGAATTTTGCGTACAAGAATTTTGCGTACATCGAAACTAAATTTTGCGTACATCGAAACTATTCACTATTCAATAACCTTTTACGCTCATCAATAACCTTTTACGCTCACTTTTCACTTTTCTTATTTATACCCTATAGCTTATTTATACCCTATAGTTAGATA

Full Affymetrix probeset data:

Annotations for 1631612_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime