FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631614_at:

>probe:Drosophila_2:1631614_at:184:203; Interrogation_Position=1024; Antisense; AAGCCAAACGATTGGGCCTTCGGAT
>probe:Drosophila_2:1631614_at:322:525; Interrogation_Position=1094; Antisense; GGGAAAGTCGCTAACTCTAAACCAG
>probe:Drosophila_2:1631614_at:335:585; Interrogation_Position=1135; Antisense; TGGACCTCAAGAAAACCGGCGACTG
>probe:Drosophila_2:1631614_at:204:505; Interrogation_Position=1179; Antisense; GTGCCCCGTCGGAAGGTCGTGCAAA
>probe:Drosophila_2:1631614_at:200:183; Interrogation_Position=1201; Antisense; AAAACGAATTCCAGCCGCGCAGGGA
>probe:Drosophila_2:1631614_at:436:561; Interrogation_Position=1245; Antisense; GGCACGCGGGCCAGGAAGCTTAATA
>probe:Drosophila_2:1631614_at:432:427; Interrogation_Position=1365; Antisense; GAGTTCCAACTGGACACTTGGGCAA
>probe:Drosophila_2:1631614_at:384:429; Interrogation_Position=852; Antisense; GAGTTCCCGATAAATTTGCATAGCA
>probe:Drosophila_2:1631614_at:356:359; Interrogation_Position=874; Antisense; GCAAGTGCTTTACGGAACTCTTTCC
>probe:Drosophila_2:1631614_at:297:209; Interrogation_Position=900; Antisense; AAGCAGAACCTGGTCTACCTAACGC
>probe:Drosophila_2:1631614_at:552:317; Interrogation_Position=931; Antisense; GCCGGGAGGATCTGGTCACTTACAA
>probe:Drosophila_2:1631614_at:634:55; Interrogation_Position=961; Antisense; ATGACATCTACATCGTGGGCGCCAT
>probe:Drosophila_2:1631614_at:82:595; Interrogation_Position=976; Antisense; TGGGCGCCATGGTAGACACTATGAA
>probe:Drosophila_2:1631614_at:261:383; Interrogation_Position=990; Antisense; GACACTATGAACAACGAACCCCTTT

Paste this into a BLAST search page for me
AAGCCAAACGATTGGGCCTTCGGATGGGAAAGTCGCTAACTCTAAACCAGTGGACCTCAAGAAAACCGGCGACTGGTGCCCCGTCGGAAGGTCGTGCAAAAAAACGAATTCCAGCCGCGCAGGGAGGCACGCGGGCCAGGAAGCTTAATAGAGTTCCAACTGGACACTTGGGCAAGAGTTCCCGATAAATTTGCATAGCAGCAAGTGCTTTACGGAACTCTTTCCAAGCAGAACCTGGTCTACCTAACGCGCCGGGAGGATCTGGTCACTTACAAATGACATCTACATCGTGGGCGCCATTGGGCGCCATGGTAGACACTATGAAGACACTATGAACAACGAACCCCTTT

Full Affymetrix probeset data:

Annotations for 1631614_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720