Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631615_at:

>probe:Drosophila_2:1631615_at:205:201; Interrogation_Position=2872; Antisense; AACCTGCACGCGCACATTATGGAGG
>probe:Drosophila_2:1631615_at:97:127; Interrogation_Position=2902; Antisense; AGCCGGCAGTTCGAGCTCAGGATTG
>probe:Drosophila_2:1631615_at:106:63; Interrogation_Position=2939; Antisense; ATGTCCGCGAGTTGCGTATCATGCA
>probe:Drosophila_2:1631615_at:336:113; Interrogation_Position=2969; Antisense; AGCACCTGGCGTGGCTGAAGACACA
>probe:Drosophila_2:1631615_at:572:211; Interrogation_Position=2986; Antisense; AAGACACACTGTATGCTGACCGACG
>probe:Drosophila_2:1631615_at:717:133; Interrogation_Position=3008; Antisense; ACGAATTTAAGGCATTCCGCGTCGC
>probe:Drosophila_2:1631615_at:109:95; Interrogation_Position=3041; Antisense; AGATCTTTCATCTGGTCTACGTGCT
>probe:Drosophila_2:1631615_at:328:341; Interrogation_Position=3119; Antisense; GCTTGGACGTCACCATTTCGGATGA
>probe:Drosophila_2:1631615_at:334:197; Interrogation_Position=3167; Antisense; AACGTCGTAGCTTGGAGTACCTGGC
>probe:Drosophila_2:1631615_at:378:667; Interrogation_Position=3223; Antisense; TACATACGTTGCCACCAGATGCTGG
>probe:Drosophila_2:1631615_at:353:141; Interrogation_Position=3284; Antisense; ACGGATTCCTGTCTGCCTTGGAGGA
>probe:Drosophila_2:1631615_at:544:629; Interrogation_Position=3319; Antisense; TCCAGTGTGCCCCATTAGAATCGAA
>probe:Drosophila_2:1631615_at:95:677; Interrogation_Position=3334; Antisense; TAGAATCGAATCTCCTCCACAAAGG
>probe:Drosophila_2:1631615_at:487:179; Interrogation_Position=3367; Antisense; AAACATTACGCATTACCATCACCTG

Paste this into a BLAST search page for me
AACCTGCACGCGCACATTATGGAGGAGCCGGCAGTTCGAGCTCAGGATTGATGTCCGCGAGTTGCGTATCATGCAAGCACCTGGCGTGGCTGAAGACACAAAGACACACTGTATGCTGACCGACGACGAATTTAAGGCATTCCGCGTCGCAGATCTTTCATCTGGTCTACGTGCTGCTTGGACGTCACCATTTCGGATGAAACGTCGTAGCTTGGAGTACCTGGCTACATACGTTGCCACCAGATGCTGGACGGATTCCTGTCTGCCTTGGAGGATCCAGTGTGCCCCATTAGAATCGAATAGAATCGAATCTCCTCCACAAAGGAAACATTACGCATTACCATCACCTG

Full Affymetrix probeset data:

Annotations for 1631615_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime