FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631616_at:

>probe:Drosophila_2:1631616_at:392:519; Interrogation_Position=100; Antisense; GTGGTGCGCAGTGTGCCTGTGGTCC
>probe:Drosophila_2:1631616_at:182:577; Interrogation_Position=129; Antisense; TGTGCCGGTGGTTCGCCGTGTCAAT
>probe:Drosophila_2:1631616_at:14:591; Interrogation_Position=137; Antisense; TGGTTCGCCGTGTCAATGTGGTCGA
>probe:Drosophila_2:1631616_at:95:515; Interrogation_Position=146; Antisense; GTGTCAATGTGGTCGAGTCCGTTCC
>probe:Drosophila_2:1631616_at:635:229; Interrogation_Position=151; Antisense; AATGTGGTCGAGTCCGTTCCAGTGG
>probe:Drosophila_2:1631616_at:369:1; Interrogation_Position=161; Antisense; AGTCCGTTCCAGTGGTGCCCTCGGT
>probe:Drosophila_2:1631616_at:416:319; Interrogation_Position=177; Antisense; GCCCTCGGTGGTGCGCGTTGGACAG
>probe:Drosophila_2:1631616_at:305:37; Interrogation_Position=208; Antisense; ATCTACGATGCTCCACTGGTGCAGT
>probe:Drosophila_2:1631616_at:293:309; Interrogation_Position=220; Antisense; CCACTGGTGCAGTCCTATGGTGGAT
>probe:Drosophila_2:1631616_at:90:629; Interrogation_Position=232; Antisense; TCCTATGGTGGATGGTTGAAGCAGA
>probe:Drosophila_2:1631616_at:125:85; Interrogation_Position=26; Antisense; AGTGCAGTGTCATCTACTCGCCGGT
>probe:Drosophila_2:1631616_at:659:83; Interrogation_Position=31; Antisense; AGTGTCATCTACTCGCCGGTGTCCT
>probe:Drosophila_2:1631616_at:27:1; Interrogation_Position=65; Antisense; TGGTCCGTTCCGTGCCCGTTATTCG
>probe:Drosophila_2:1631616_at:659:475; Interrogation_Position=82; Antisense; GTTATTCGCTCCGTTCCGGTGGTGC

Paste this into a BLAST search page for me
GTGGTGCGCAGTGTGCCTGTGGTCCTGTGCCGGTGGTTCGCCGTGTCAATTGGTTCGCCGTGTCAATGTGGTCGAGTGTCAATGTGGTCGAGTCCGTTCCAATGTGGTCGAGTCCGTTCCAGTGGAGTCCGTTCCAGTGGTGCCCTCGGTGCCCTCGGTGGTGCGCGTTGGACAGATCTACGATGCTCCACTGGTGCAGTCCACTGGTGCAGTCCTATGGTGGATTCCTATGGTGGATGGTTGAAGCAGAAGTGCAGTGTCATCTACTCGCCGGTAGTGTCATCTACTCGCCGGTGTCCTTGGTCCGTTCCGTGCCCGTTATTCGGTTATTCGCTCCGTTCCGGTGGTGC

Full Affymetrix probeset data:

Annotations for 1631616_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720