FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631617_at:

>probe:Drosophila_2:1631617_at:215:479; Interrogation_Position=1537; Antisense; GTTTACTTCAAACTACTAGCGCGTG
>probe:Drosophila_2:1631617_at:9:675; Interrogation_Position=1553; Antisense; TAGCGCGTGCGAATGGATCCACCAA
>probe:Drosophila_2:1631617_at:239:107; Interrogation_Position=1634; Antisense; AGAAATTCCTCGACTCCTGCAAAGT
>probe:Drosophila_2:1631617_at:37:123; Interrogation_Position=1660; Antisense; AGCGATGACGCCCAACTAAGAGCAT
>probe:Drosophila_2:1631617_at:582:279; Interrogation_Position=1675; Antisense; CTAAGAGCATTTAGTGCCCGCCATG
>probe:Drosophila_2:1631617_at:679:225; Interrogation_Position=1717; Antisense; AAGGCATTGCATGTCGAACCCGGAA
>probe:Drosophila_2:1631617_at:386:465; Interrogation_Position=1744; Antisense; GTTGTCGACGGTTCATTTGATCTCA
>probe:Drosophila_2:1631617_at:573:491; Interrogation_Position=1769; Antisense; GTAAATCAAGCTACATTCGCCATGG
>probe:Drosophila_2:1631617_at:397:269; Interrogation_Position=1798; Antisense; CATAAATGTCCGGTCTCTAGTCTAA
>probe:Drosophila_2:1631617_at:143:637; Interrogation_Position=1827; Antisense; TCGACGGAGTGAATTGGCGCCTAAA
>probe:Drosophila_2:1631617_at:94:25; Interrogation_Position=1869; Antisense; ATATGAGGCTTCTCTTCAACTGACC
>probe:Drosophila_2:1631617_at:199:337; Interrogation_Position=1915; Antisense; GCTGCCGACTGGGAATTGCTCAAGA
>probe:Drosophila_2:1631617_at:62:435; Interrogation_Position=1956; Antisense; GAGTGGAATTGTACCCTAGCTCCCT
>probe:Drosophila_2:1631617_at:598:695; Interrogation_Position=1991; Antisense; TTTCGTATCGCTCACTTACCTAAAT

Paste this into a BLAST search page for me
GTTTACTTCAAACTACTAGCGCGTGTAGCGCGTGCGAATGGATCCACCAAAGAAATTCCTCGACTCCTGCAAAGTAGCGATGACGCCCAACTAAGAGCATCTAAGAGCATTTAGTGCCCGCCATGAAGGCATTGCATGTCGAACCCGGAAGTTGTCGACGGTTCATTTGATCTCAGTAAATCAAGCTACATTCGCCATGGCATAAATGTCCGGTCTCTAGTCTAATCGACGGAGTGAATTGGCGCCTAAAATATGAGGCTTCTCTTCAACTGACCGCTGCCGACTGGGAATTGCTCAAGAGAGTGGAATTGTACCCTAGCTCCCTTTTCGTATCGCTCACTTACCTAAAT

Full Affymetrix probeset data:

Annotations for 1631617_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720