Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631620_at:

>probe:Drosophila_2:1631620_at:405:287; Interrogation_Position=2292; Antisense; CTGGACAACATCTTTATCTTCGGCA
>probe:Drosophila_2:1631620_at:534:37; Interrogation_Position=2307; Antisense; ATCTTCGGCATGACCGTCGACGAGG
>probe:Drosophila_2:1631620_at:27:341; Interrogation_Position=2353; Antisense; GCTACAATGCCTACGACTACTACAA
>probe:Drosophila_2:1631620_at:468:309; Interrogation_Position=2380; Antisense; CCAACCCCGAGGTCAAGCAGGTGAT
>probe:Drosophila_2:1631620_at:359:513; Interrogation_Position=2400; Antisense; GTGATTGACCAAATCCAGGGCGGAT
>probe:Drosophila_2:1631620_at:538:303; Interrogation_Position=2434; Antisense; CCGGCAATCCCAACGAGTTCAAGAA
>probe:Drosophila_2:1631620_at:338:385; Interrogation_Position=2456; Antisense; GAACATTGCCGACATTCTGCTTAAG
>probe:Drosophila_2:1631620_at:451:217; Interrogation_Position=2478; Antisense; AAGTACGACCACTACTACTTGCTGG
>probe:Drosophila_2:1631620_at:502:445; Interrogation_Position=2511; Antisense; GATGCGTACATCAAGGCCCAGGATC
>probe:Drosophila_2:1631620_at:407:103; Interrogation_Position=2545; Antisense; AGACCTACCAGAACCAAGCCAAGTG
>probe:Drosophila_2:1631620_at:506:597; Interrogation_Position=2578; Antisense; TGTCCATCAACAACATTGCGTCCAG
>probe:Drosophila_2:1631620_at:265:505; Interrogation_Position=2597; Antisense; GTCCAGCGGCAAATTCTCGTCGGAT
>probe:Drosophila_2:1631620_at:141:651; Interrogation_Position=2762; Antisense; TCAAAGTTCAAGTTTAGGCGCCAAA
>probe:Drosophila_2:1631620_at:697:289; Interrogation_Position=2816; Antisense; CGGGCCACAGCACCGAATTGTTAAT

Paste this into a BLAST search page for me
CTGGACAACATCTTTATCTTCGGCAATCTTCGGCATGACCGTCGACGAGGGCTACAATGCCTACGACTACTACAACCAACCCCGAGGTCAAGCAGGTGATGTGATTGACCAAATCCAGGGCGGATCCGGCAATCCCAACGAGTTCAAGAAGAACATTGCCGACATTCTGCTTAAGAAGTACGACCACTACTACTTGCTGGGATGCGTACATCAAGGCCCAGGATCAGACCTACCAGAACCAAGCCAAGTGTGTCCATCAACAACATTGCGTCCAGGTCCAGCGGCAAATTCTCGTCGGATTCAAAGTTCAAGTTTAGGCGCCAAACGGGCCACAGCACCGAATTGTTAAT

Full Affymetrix probeset data:

Annotations for 1631620_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime