Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631622_at:

>probe:Drosophila_2:1631622_at:483:219; Interrogation_Position=1115; Antisense; AAGTGGTTCTGGTGGCGAGTCCATT
>probe:Drosophila_2:1631622_at:704:709; Interrogation_Position=1165; Antisense; TTAAGCCGAATCTTACGCACACGGG
>probe:Drosophila_2:1631622_at:395:157; Interrogation_Position=1183; Antisense; ACACGGGCCGAGGAGTGCTATCAAT
>probe:Drosophila_2:1631622_at:214:341; Interrogation_Position=1199; Antisense; GCTATCAATGGCCAATTCGGGACCC
>probe:Drosophila_2:1631622_at:353:67; Interrogation_Position=1231; Antisense; ATGGCTCTCAGTTCTTTATCACCTA
>probe:Drosophila_2:1631622_at:633:685; Interrogation_Position=1247; Antisense; TATCACCTATCGCTCTTGCAAACAT
>probe:Drosophila_2:1631622_at:540:407; Interrogation_Position=1275; Antisense; GACGGCAAACACACCATCTTTGGAA
>probe:Drosophila_2:1631622_at:246:501; Interrogation_Position=1305; Antisense; GTCGGAGGATTAGACACTCTTCAAA
>probe:Drosophila_2:1631622_at:559:273; Interrogation_Position=1382; Antisense; CATTGAGTCCTCACAGGTCTTTGTG
>probe:Drosophila_2:1631622_at:335:537; Interrogation_Position=1397; Antisense; GGTCTTTGTGAATCCATTTGCCGAG
>probe:Drosophila_2:1631622_at:326:19; Interrogation_Position=1412; Antisense; ATTTGCCGAGGCAGCCGAACAGTTG
>probe:Drosophila_2:1631622_at:482:523; Interrogation_Position=1535; Antisense; GGGCGTAGGCAAGTACCTGAAACTT
>probe:Drosophila_2:1631622_at:53:709; Interrogation_Position=1591; Antisense; TTACATCCGCTCAAGCAGCCAAGAA
>probe:Drosophila_2:1631622_at:134:427; Interrogation_Position=1639; Antisense; GAGATTTCTCCAGTTGGTAACCCAT

Paste this into a BLAST search page for me
AAGTGGTTCTGGTGGCGAGTCCATTTTAAGCCGAATCTTACGCACACGGGACACGGGCCGAGGAGTGCTATCAATGCTATCAATGGCCAATTCGGGACCCATGGCTCTCAGTTCTTTATCACCTATATCACCTATCGCTCTTGCAAACATGACGGCAAACACACCATCTTTGGAAGTCGGAGGATTAGACACTCTTCAAACATTGAGTCCTCACAGGTCTTTGTGGGTCTTTGTGAATCCATTTGCCGAGATTTGCCGAGGCAGCCGAACAGTTGGGGCGTAGGCAAGTACCTGAAACTTTTACATCCGCTCAAGCAGCCAAGAAGAGATTTCTCCAGTTGGTAACCCAT

Full Affymetrix probeset data:

Annotations for 1631622_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime