FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631624_at:

>probe:Drosophila_2:1631624_at:42:355; Interrogation_Position=1002; Antisense; GCACTACGCGAATGGGCCACGGGTT
>probe:Drosophila_2:1631624_at:260:693; Interrogation_Position=1048; Antisense; TTTGTGAGCTTCACCACTCGGAGAC
>probe:Drosophila_2:1631624_at:365:529; Interrogation_Position=1074; Antisense; GGGTTCGGAGCGTATCAGGCCATTC
>probe:Drosophila_2:1631624_at:650:133; Interrogation_Position=1120; Antisense; ACGCCCGATTTGTTTGCTGGACGCT
>probe:Drosophila_2:1631624_at:569:585; Interrogation_Position=1137; Antisense; TGGACGCTCCTCGAAATCATTGATC
>probe:Drosophila_2:1631624_at:121:647; Interrogation_Position=1153; Antisense; TCATTGATCGACTCGTACATTCCCA
>probe:Drosophila_2:1631624_at:544:435; Interrogation_Position=1183; Antisense; GAGGTACTGCGCCTGATCAGACAGC
>probe:Drosophila_2:1631624_at:21:353; Interrogation_Position=1215; Antisense; GCAGCAAGGATTCACGCCCATCGCA
>probe:Drosophila_2:1631624_at:270:439; Interrogation_Position=1275; Antisense; GAGGCTCTACAAGCGAGATTCCCAG
>probe:Drosophila_2:1631624_at:303:91; Interrogation_Position=1290; Antisense; AGATTCCCAGGAGGACCGGTCGAGA
>probe:Drosophila_2:1631624_at:241:379; Interrogation_Position=1336; Antisense; GAACCTTAGAGTTCGAGTTCGGGCT
>probe:Drosophila_2:1631624_at:337:635; Interrogation_Position=1354; Antisense; TCGGGCTTAGCGTACGATTTAATTT
>probe:Drosophila_2:1631624_at:273:415; Interrogation_Position=875; Antisense; GAGCGCCGTTCATCTACGGATTTAC
>probe:Drosophila_2:1631624_at:642:619; Interrogation_Position=947; Antisense; TGCTGGTCCAGCAGTCCAAACAGTT

Paste this into a BLAST search page for me
GCACTACGCGAATGGGCCACGGGTTTTTGTGAGCTTCACCACTCGGAGACGGGTTCGGAGCGTATCAGGCCATTCACGCCCGATTTGTTTGCTGGACGCTTGGACGCTCCTCGAAATCATTGATCTCATTGATCGACTCGTACATTCCCAGAGGTACTGCGCCTGATCAGACAGCGCAGCAAGGATTCACGCCCATCGCAGAGGCTCTACAAGCGAGATTCCCAGAGATTCCCAGGAGGACCGGTCGAGAGAACCTTAGAGTTCGAGTTCGGGCTTCGGGCTTAGCGTACGATTTAATTTGAGCGCCGTTCATCTACGGATTTACTGCTGGTCCAGCAGTCCAAACAGTT

Full Affymetrix probeset data:

Annotations for 1631624_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720