Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631625_at:

>probe:Drosophila_2:1631625_at:18:687; Interrogation_Position=102; Antisense; TATAATATTGCTGCCCACCAATCGA
>probe:Drosophila_2:1631625_at:339:237; Interrogation_Position=121; Antisense; AATCGACCGGCAACCAGGATTCAAA
>probe:Drosophila_2:1631625_at:348:177; Interrogation_Position=143; Antisense; AAACGGCCGCCGACATGCGCTATCT
>probe:Drosophila_2:1631625_at:189:617; Interrogation_Position=167; Antisense; TGCACGACCTGAATGTCCAGATCTC
>probe:Drosophila_2:1631625_at:152:599; Interrogation_Position=18; Antisense; TGTATCCCCGTGCAAAACAAATCGA
>probe:Drosophila_2:1631625_at:548:97; Interrogation_Position=185; Antisense; AGATCTCGCAGAACCGTCGATCCGT
>probe:Drosophila_2:1631625_at:726:291; Interrogation_Position=207; Antisense; CGTCTCCGTTTCCAAGCAACTGGAC
>probe:Drosophila_2:1631625_at:532:529; Interrogation_Position=233; Antisense; GGGATCTGTGCAACCAACATTTCGA
>probe:Drosophila_2:1631625_at:180:617; Interrogation_Position=241; Antisense; TGCAACCAACATTTCGACACATTCG
>probe:Drosophila_2:1631625_at:339:265; Interrogation_Position=279; Antisense; CAGACCAGGACATGGAGCCCGTGGC
>probe:Drosophila_2:1631625_at:19:417; Interrogation_Position=293; Antisense; GAGCCCGTGGCGACAAGATCAACAA
>probe:Drosophila_2:1631625_at:209:195; Interrogation_Position=317; Antisense; AACTGAAACTGGACAATCTGCTCTA
>probe:Drosophila_2:1631625_at:721:161; Interrogation_Position=329; Antisense; ACAATCTGCTCTATGGCGCCAGCGA
>probe:Drosophila_2:1631625_at:114:645; Interrogation_Position=338; Antisense; TCTATGGCGCCAGCGAATCGGCGTA

Paste this into a BLAST search page for me
TATAATATTGCTGCCCACCAATCGAAATCGACCGGCAACCAGGATTCAAAAAACGGCCGCCGACATGCGCTATCTTGCACGACCTGAATGTCCAGATCTCTGTATCCCCGTGCAAAACAAATCGAAGATCTCGCAGAACCGTCGATCCGTCGTCTCCGTTTCCAAGCAACTGGACGGGATCTGTGCAACCAACATTTCGATGCAACCAACATTTCGACACATTCGCAGACCAGGACATGGAGCCCGTGGCGAGCCCGTGGCGACAAGATCAACAAAACTGAAACTGGACAATCTGCTCTAACAATCTGCTCTATGGCGCCAGCGATCTATGGCGCCAGCGAATCGGCGTA

Full Affymetrix probeset data:

Annotations for 1631625_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime