Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631626_at:

>probe:Drosophila_2:1631626_at:695:139; Interrogation_Position=2256; Antisense; ACGGTGTTGGCGATGGTCAGCTCTA
>probe:Drosophila_2:1631626_at:699:441; Interrogation_Position=2267; Antisense; GATGGTCAGCTCTACCAGGTGGTAA
>probe:Drosophila_2:1631626_at:339:549; Interrogation_Position=2353; Antisense; GGAGGGCTGTCGCATGACATTTATA
>probe:Drosophila_2:1631626_at:584:653; Interrogation_Position=2395; Antisense; TAATTCTCGCTACTTTACTGGGCAT
>probe:Drosophila_2:1631626_at:466:93; Interrogation_Position=2428; Antisense; AGTTCCGGGCACTGTAGTCGATGAC
>probe:Drosophila_2:1631626_at:381:443; Interrogation_Position=2447; Antisense; GATGACGTTATTACCTTGCCAGAGC
>probe:Drosophila_2:1631626_at:92:103; Interrogation_Position=2467; Antisense; AGAGCGCTACGACTTCTTCCTAGTG
>probe:Drosophila_2:1631626_at:672:79; Interrogation_Position=2488; Antisense; AGTGTCCCAGGCTGTTCGGATAGGA
>probe:Drosophila_2:1631626_at:386:457; Interrogation_Position=2506; Antisense; GATAGGAACTGTGTCGCCTACCAGC
>probe:Drosophila_2:1631626_at:526:397; Interrogation_Position=2546; Antisense; GACAACATGGGACTAAACGCCGATA
>probe:Drosophila_2:1631626_at:387:455; Interrogation_Position=2567; Antisense; GATAAGCTGCAGATGCTCTCCTATA
>probe:Drosophila_2:1631626_at:167:447; Interrogation_Position=2578; Antisense; GATGCTCTCCTATAAGATGACCCAT
>probe:Drosophila_2:1631626_at:694:161; Interrogation_Position=2660; Antisense; AAATTGGCTTTCCTCGTAGCCGAAT
>probe:Drosophila_2:1631626_at:654:365; Interrogation_Position=2681; Antisense; GAATCCATTAATCGTGCGCCTTCAG

Paste this into a BLAST search page for me
ACGGTGTTGGCGATGGTCAGCTCTAGATGGTCAGCTCTACCAGGTGGTAAGGAGGGCTGTCGCATGACATTTATATAATTCTCGCTACTTTACTGGGCATAGTTCCGGGCACTGTAGTCGATGACGATGACGTTATTACCTTGCCAGAGCAGAGCGCTACGACTTCTTCCTAGTGAGTGTCCCAGGCTGTTCGGATAGGAGATAGGAACTGTGTCGCCTACCAGCGACAACATGGGACTAAACGCCGATAGATAAGCTGCAGATGCTCTCCTATAGATGCTCTCCTATAAGATGACCCATAAATTGGCTTTCCTCGTAGCCGAATGAATCCATTAATCGTGCGCCTTCAG

Full Affymetrix probeset data:

Annotations for 1631626_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime