FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631627_at:

>probe:Drosophila_2:1631627_at:279:135; Interrogation_Position=1018; Antisense; ACGCGAGGTTTTGACTGCAGTGGAC
>probe:Drosophila_2:1631627_at:482:475; Interrogation_Position=1044; Antisense; GTTATAACTTCTTCAGCTACACCTG
>probe:Drosophila_2:1631627_at:271:577; Interrogation_Position=1068; Antisense; GGCGCACACCTAATGCCATGATGAA
>probe:Drosophila_2:1631627_at:538:629; Interrogation_Position=1171; Antisense; TCCTACGTGCGCTGGCTTCGAAAAA
>probe:Drosophila_2:1631627_at:227:631; Interrogation_Position=1199; Antisense; TCCCGCCATGATTACGAATGCGTTT
>probe:Drosophila_2:1631627_at:725:263; Interrogation_Position=689; Antisense; CATCGTACTGTGTTTCCAAATCCGT
>probe:Drosophila_2:1631627_at:563:309; Interrogation_Position=764; Antisense; CCAATTTTGTTTAGTCCGGGCCATG
>probe:Drosophila_2:1631627_at:692:629; Interrogation_Position=778; Antisense; TCCGGGCCATGTGATTGTCCTTACA
>probe:Drosophila_2:1631627_at:685:721; Interrogation_Position=792; Antisense; TTGTCCTTACAGCTCGGTGTTTCGA
>probe:Drosophila_2:1631627_at:261:267; Interrogation_Position=847; Antisense; CATGGACTCGGATACCAAGCGCGAA
>probe:Drosophila_2:1631627_at:572:665; Interrogation_Position=876; Antisense; TACACTTCAGTGTGCGTTTCGATGA
>probe:Drosophila_2:1631627_at:703:567; Interrogation_Position=904; Antisense; GGCAGTAGTGCGCAATTCCATGAAC
>probe:Drosophila_2:1631627_at:501:73; Interrogation_Position=951; Antisense; AGGAGCGTCATGGAGGTTTCCCCTT
>probe:Drosophila_2:1631627_at:24:207; Interrogation_Position=995; Antisense; AAGCTGGCGCTTGCGTTTACGGAAC

Paste this into a BLAST search page for me
ACGCGAGGTTTTGACTGCAGTGGACGTTATAACTTCTTCAGCTACACCTGGGCGCACACCTAATGCCATGATGAATCCTACGTGCGCTGGCTTCGAAAAATCCCGCCATGATTACGAATGCGTTTCATCGTACTGTGTTTCCAAATCCGTCCAATTTTGTTTAGTCCGGGCCATGTCCGGGCCATGTGATTGTCCTTACATTGTCCTTACAGCTCGGTGTTTCGACATGGACTCGGATACCAAGCGCGAATACACTTCAGTGTGCGTTTCGATGAGGCAGTAGTGCGCAATTCCATGAACAGGAGCGTCATGGAGGTTTCCCCTTAAGCTGGCGCTTGCGTTTACGGAAC

Full Affymetrix probeset data:

Annotations for 1631627_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720