Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631628_s_at:

>probe:Drosophila_2:1631628_s_at:638:9; Interrogation_Position=299; Antisense; ATTCCGTTGACGCATTGAACTCGCA
>probe:Drosophila_2:1631628_s_at:312:273; Interrogation_Position=311; Antisense; CATTGAACTCGCACGTGGACTGGGT
>probe:Drosophila_2:1631628_s_at:516:293; Interrogation_Position=320; Antisense; CGCACGTGGACTGGGTGAACGACAT
>probe:Drosophila_2:1631628_s_at:494:213; Interrogation_Position=346; Antisense; AAGAGCTATTGCCTGGACATTCCCG
>probe:Drosophila_2:1631628_s_at:185:603; Interrogation_Position=485; Antisense; TGTTCATCATCAGTCCGGACCATAA
>probe:Drosophila_2:1631628_s_at:74:33; Interrogation_Position=493; Antisense; ATCAGTCCGGACCATAAGGTGCGCC
>probe:Drosophila_2:1631628_s_at:342:555; Interrogation_Position=501; Antisense; GGACCATAAGGTGCGCCTCTCCATG
>probe:Drosophila_2:1631628_s_at:329:61; Interrogation_Position=535; Antisense; ATGTCCACTGGTCGCAACGTTGACG
>probe:Drosophila_2:1631628_s_at:191:197; Interrogation_Position=550; Antisense; AACGTTGACGAGATTCTGAGGACCA
>probe:Drosophila_2:1631628_s_at:238:95; Interrogation_Position=560; Antisense; AGATTCTGAGGACCATTGACTCCCT
>probe:Drosophila_2:1631628_s_at:616:191; Interrogation_Position=625; Antisense; AACTGGACCCCTGGCACTAAGGTCA
>probe:Drosophila_2:1631628_s_at:630:565; Interrogation_Position=637; Antisense; GGCACTAAGGTCATGATCCTGCCCA
>probe:Drosophila_2:1631628_s_at:269:439; Interrogation_Position=676; Antisense; GAGGCTCATAAACTCTTCCCCAAGG
>probe:Drosophila_2:1631628_s_at:94:663; Interrogation_Position=684; Antisense; TAAACTCTTCCCCAAGGGATTTGAT

Paste this into a BLAST search page for me
ATTCCGTTGACGCATTGAACTCGCACATTGAACTCGCACGTGGACTGGGTCGCACGTGGACTGGGTGAACGACATAAGAGCTATTGCCTGGACATTCCCGTGTTCATCATCAGTCCGGACCATAAATCAGTCCGGACCATAAGGTGCGCCGGACCATAAGGTGCGCCTCTCCATGATGTCCACTGGTCGCAACGTTGACGAACGTTGACGAGATTCTGAGGACCAAGATTCTGAGGACCATTGACTCCCTAACTGGACCCCTGGCACTAAGGTCAGGCACTAAGGTCATGATCCTGCCCAGAGGCTCATAAACTCTTCCCCAAGGTAAACTCTTCCCCAAGGGATTTGAT

Full Affymetrix probeset data:

Annotations for 1631628_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime