Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631630_at:

>probe:Drosophila_2:1631630_at:364:407; Interrogation_Position=2307; Antisense; GACTGGTCAGCGATCTGATATCCGA
>probe:Drosophila_2:1631630_at:478:369; Interrogation_Position=2365; Antisense; GAAGGCTCTACTCAAGTCGAATCAC
>probe:Drosophila_2:1631630_at:130:147; Interrogation_Position=2387; Antisense; CACTTTACGGCGCAAGGACTTCAGA
>probe:Drosophila_2:1631630_at:290:711; Interrogation_Position=2406; Antisense; TTCAGAGAACGTTGGCGGCTGCTTC
>probe:Drosophila_2:1631630_at:234:573; Interrogation_Position=2422; Antisense; GGCTGCTTCTCTGGCCAAGGAAAAC
>probe:Drosophila_2:1631630_at:698:213; Interrogation_Position=2474; Antisense; AAGAGTCCACGAGCGCTAATGGCCA
>probe:Drosophila_2:1631630_at:579:387; Interrogation_Position=2529; Antisense; GAAAACCGCTGGGATCGGCCAGTAA
>probe:Drosophila_2:1631630_at:660:75; Interrogation_Position=2553; Antisense; AGGAGCCGCCTTTGGTCAAATTCAA
>probe:Drosophila_2:1631630_at:378:163; Interrogation_Position=2570; Antisense; AAATTCAATCGTGCTGCTTCGTTCC
>probe:Drosophila_2:1631630_at:257:475; Interrogation_Position=2627; Antisense; GTTAGTTTCAACTTGTGTTTGCCTT
>probe:Drosophila_2:1631630_at:193:371; Interrogation_Position=2652; Antisense; GAAGTAACAACTATTCCGCCAGGAC
>probe:Drosophila_2:1631630_at:82:301; Interrogation_Position=2668; Antisense; CGCCAGGACCGAGACAGATTCATGT
>probe:Drosophila_2:1631630_at:181:393; Interrogation_Position=2842; Antisense; GAAAGCTTTGCGTTACGCGCTCTAA
>probe:Drosophila_2:1631630_at:516:163; Interrogation_Position=2871; Antisense; AAATATACAGCCGTTTCCTTGCCCT

Paste this into a BLAST search page for me
GACTGGTCAGCGATCTGATATCCGAGAAGGCTCTACTCAAGTCGAATCACCACTTTACGGCGCAAGGACTTCAGATTCAGAGAACGTTGGCGGCTGCTTCGGCTGCTTCTCTGGCCAAGGAAAACAAGAGTCCACGAGCGCTAATGGCCAGAAAACCGCTGGGATCGGCCAGTAAAGGAGCCGCCTTTGGTCAAATTCAAAAATTCAATCGTGCTGCTTCGTTCCGTTAGTTTCAACTTGTGTTTGCCTTGAAGTAACAACTATTCCGCCAGGACCGCCAGGACCGAGACAGATTCATGTGAAAGCTTTGCGTTACGCGCTCTAAAAATATACAGCCGTTTCCTTGCCCT

Full Affymetrix probeset data:

Annotations for 1631630_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime