FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631631_at:

>probe:Drosophila_2:1631631_at:532:561; Interrogation_Position=1007; Antisense; GGAACAGCCGTTCAATCAGTTGCAT
>probe:Drosophila_2:1631631_at:489:35; Interrogation_Position=1021; Antisense; ATCAGTTGCATTCCGGCAACTTACC
>probe:Drosophila_2:1631631_at:60:255; Interrogation_Position=1037; Antisense; CAACTTACCCGGTCAGTATGCCGGA
>probe:Drosophila_2:1631631_at:526:91; Interrogation_Position=1051; Antisense; AGTATGCCGGACAATTTGGCCAGCA
>probe:Drosophila_2:1631631_at:183:361; Interrogation_Position=1087; Antisense; GCAATCTTACTGCACAACAGGCACA
>probe:Drosophila_2:1631631_at:480:69; Interrogation_Position=1210; Antisense; AGGCCCTAATCACCCAACAACTGAG
>probe:Drosophila_2:1631631_at:208:567; Interrogation_Position=1236; Antisense; GGCAGACCGAACAACCTGGTGGATC
>probe:Drosophila_2:1631631_at:100:201; Interrogation_Position=1248; Antisense; AACCTGGTGGATCCATATGGCTATA
>probe:Drosophila_2:1631631_at:580:571; Interrogation_Position=1266; Antisense; GGCTATAATCAGTACGGCAGACGCT
>probe:Drosophila_2:1631631_at:532:565; Interrogation_Position=1281; Antisense; GGCAGACGCTTCAAGAAGTCCCCAA
>probe:Drosophila_2:1631631_at:569:441; Interrogation_Position=1353; Antisense; GATGTAGTCGCAACTCAAAGGCATG
>probe:Drosophila_2:1631631_at:172:245; Interrogation_Position=815; Antisense; CAATTTGAATCCATACCAGACGCCC
>probe:Drosophila_2:1631631_at:18:469; Interrogation_Position=947; Antisense; GTTGCAACAGCAACGCGGTTTCCAG
>probe:Drosophila_2:1631631_at:687:525; Interrogation_Position=993; Antisense; GGGCAATATCAACCGGAACAGCCGT

Paste this into a BLAST search page for me
GGAACAGCCGTTCAATCAGTTGCATATCAGTTGCATTCCGGCAACTTACCCAACTTACCCGGTCAGTATGCCGGAAGTATGCCGGACAATTTGGCCAGCAGCAATCTTACTGCACAACAGGCACAAGGCCCTAATCACCCAACAACTGAGGGCAGACCGAACAACCTGGTGGATCAACCTGGTGGATCCATATGGCTATAGGCTATAATCAGTACGGCAGACGCTGGCAGACGCTTCAAGAAGTCCCCAAGATGTAGTCGCAACTCAAAGGCATGCAATTTGAATCCATACCAGACGCCCGTTGCAACAGCAACGCGGTTTCCAGGGGCAATATCAACCGGAACAGCCGT

Full Affymetrix probeset data:

Annotations for 1631631_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720