FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631635_at:

>probe:Drosophila_2:1631635_at:711:477; Interrogation_Position=125; Antisense; GTTTCGGCCCTACCGCAATTTGGAT
>probe:Drosophila_2:1631635_at:5:133; Interrogation_Position=136; Antisense; ACCGCAATTTGGATTCGGACGACCA
>probe:Drosophila_2:1631635_at:608:5; Interrogation_Position=148; Antisense; ATTCGGACGACCAGGATTTGGTGGC
>probe:Drosophila_2:1631635_at:66:637; Interrogation_Position=285; Antisense; TCGGTAATCCCTATGGCGGCGGATT
>probe:Drosophila_2:1631635_at:34:107; Interrogation_Position=29; Antisense; AGACAACCCAGCGATCGCACAGATA
>probe:Drosophila_2:1631635_at:627:261; Interrogation_Position=37; Antisense; CAGCGATCGCACAGATAGAATCTAT
>probe:Drosophila_2:1631635_at:523:37; Interrogation_Position=373; Antisense; ATCTTCGTCAGCCTCTGCAGCTGGT
>probe:Drosophila_2:1631635_at:576:251; Interrogation_Position=444; Antisense; CAAGCGGTGGTGGTTTCTACGGATA
>probe:Drosophila_2:1631635_at:619:589; Interrogation_Position=454; Antisense; TGGTTTCTACGGATAAGCTGCCAGA
>probe:Drosophila_2:1631635_at:631:207; Interrogation_Position=468; Antisense; AAGCTGCCAGAGAGCGGATTATCTA
>probe:Drosophila_2:1631635_at:7:677; Interrogation_Position=52; Antisense; TAGAATCTATCAAACTCACAGAAGA
>probe:Drosophila_2:1631635_at:643:363; Interrogation_Position=75; Antisense; GAATTCTCGCAATGAAGACTCTGAT
>probe:Drosophila_2:1631635_at:95:615; Interrogation_Position=87; Antisense; TGAAGACTCTGATTGTTCTCGCTCT
>probe:Drosophila_2:1631635_at:84:605; Interrogation_Position=96; Antisense; TGATTGTTCTCGCTCTTCTGGTGGC

Paste this into a BLAST search page for me
GTTTCGGCCCTACCGCAATTTGGATACCGCAATTTGGATTCGGACGACCAATTCGGACGACCAGGATTTGGTGGCTCGGTAATCCCTATGGCGGCGGATTAGACAACCCAGCGATCGCACAGATACAGCGATCGCACAGATAGAATCTATATCTTCGTCAGCCTCTGCAGCTGGTCAAGCGGTGGTGGTTTCTACGGATATGGTTTCTACGGATAAGCTGCCAGAAAGCTGCCAGAGAGCGGATTATCTATAGAATCTATCAAACTCACAGAAGAGAATTCTCGCAATGAAGACTCTGATTGAAGACTCTGATTGTTCTCGCTCTTGATTGTTCTCGCTCTTCTGGTGGC

Full Affymetrix probeset data:

Annotations for 1631635_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720