Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631636_at:

>probe:Drosophila_2:1631636_at:480:635; Interrogation_Position=1695; Antisense; TCGCGAGCAGCGTATGCTCAAGCTT
>probe:Drosophila_2:1631636_at:586:231; Interrogation_Position=1732; Antisense; AATGAGGTGCTGTCCAAATTTGCCA
>probe:Drosophila_2:1631636_at:612:163; Interrogation_Position=1747; Antisense; AAATTTGCCATGACCAAGGATGCGG
>probe:Drosophila_2:1631636_at:685:445; Interrogation_Position=1765; Antisense; GATGCGGAGTTCATTAAGCTCACCA
>probe:Drosophila_2:1631636_at:91:709; Interrogation_Position=1778; Antisense; TTAAGCTCACCAGCGACCAGGTCAA
>probe:Drosophila_2:1631636_at:393:307; Interrogation_Position=1794; Antisense; CCAGGTCAAGCGCAAGGCCCAGTTG
>probe:Drosophila_2:1631636_at:380:251; Interrogation_Position=1806; Antisense; CAAGGCCCAGTTGCGCAAAGAGAAG
>probe:Drosophila_2:1631636_at:133:111; Interrogation_Position=1826; Antisense; AGAAGGCTGCACTGCTGGCTGCTGA
>probe:Drosophila_2:1631636_at:470:333; Interrogation_Position=1846; Antisense; GCTGATGCCGCTCCAAAGGACAATG
>probe:Drosophila_2:1631636_at:1:557; Interrogation_Position=1878; Antisense; GGACGCAGCAGTGCCCGCGAAAAAA
>probe:Drosophila_2:1631636_at:695:181; Interrogation_Position=1899; Antisense; AAAAGCTCGCAAGGAGTCCAGCAGC
>probe:Drosophila_2:1631636_at:458:323; Interrogation_Position=1928; Antisense; GCGCAAAGGCTGATGCAGAATCCGA
>probe:Drosophila_2:1631636_at:422:241; Interrogation_Position=2159; Antisense; AATACGTCAGTCTCATTGCTCATTG
>probe:Drosophila_2:1631636_at:490:159; Interrogation_Position=2214; Antisense; ACAATCTTGCTATAATTCCGTTTGC

Paste this into a BLAST search page for me
TCGCGAGCAGCGTATGCTCAAGCTTAATGAGGTGCTGTCCAAATTTGCCAAAATTTGCCATGACCAAGGATGCGGGATGCGGAGTTCATTAAGCTCACCATTAAGCTCACCAGCGACCAGGTCAACCAGGTCAAGCGCAAGGCCCAGTTGCAAGGCCCAGTTGCGCAAAGAGAAGAGAAGGCTGCACTGCTGGCTGCTGAGCTGATGCCGCTCCAAAGGACAATGGGACGCAGCAGTGCCCGCGAAAAAAAAAAGCTCGCAAGGAGTCCAGCAGCGCGCAAAGGCTGATGCAGAATCCGAAATACGTCAGTCTCATTGCTCATTGACAATCTTGCTATAATTCCGTTTGC

Full Affymetrix probeset data:

Annotations for 1631636_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime