FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631638_at:

>probe:Drosophila_2:1631638_at:614:477; Interrogation_Position=1290; Antisense; GTTTGAGGACAGTTGGTTCGCCACG
>probe:Drosophila_2:1631638_at:272:265; Interrogation_Position=1299; Antisense; CAGTTGGTTCGCCACGGAGTACGAA
>probe:Drosophila_2:1631638_at:99:671; Interrogation_Position=1318; Antisense; TACGAAGTAGAAACGCCAGCCTCCT
>probe:Drosophila_2:1631638_at:379:563; Interrogation_Position=1348; Antisense; GGAATCCCCGAGTACTGAGAAGGCA
>probe:Drosophila_2:1631638_at:240:527; Interrogation_Position=1380; Antisense; GGGAATTGCACCGTGTACTTTATAA
>probe:Drosophila_2:1631638_at:691:707; Interrogation_Position=1455; Antisense; TTAACACACAGTATTTACCCCACTC
>probe:Drosophila_2:1631638_at:21:543; Interrogation_Position=1510; Antisense; GGTTGCGCAGAAATCTCTGACGATT
>probe:Drosophila_2:1631638_at:343:641; Interrogation_Position=1525; Antisense; TCTGACGATTCGATATTTGCCTAAA
>probe:Drosophila_2:1631638_at:259:61; Interrogation_Position=1555; Antisense; ATGGTTGGCCAGTAAAAATCCACAG
>probe:Drosophila_2:1631638_at:458:549; Interrogation_Position=1624; Antisense; GGAGATTTCTGCACAAATCCTGTAC
>probe:Drosophila_2:1631638_at:220:701; Interrogation_Position=1679; Antisense; TTTTAAGCGCCTTTCACTTTGTAGC
>probe:Drosophila_2:1631638_at:510:487; Interrogation_Position=1699; Antisense; GTAGCGGCTTTGTACACATTTGTTG
>probe:Drosophila_2:1631638_at:695:207; Interrogation_Position=1776; Antisense; AAGACTTTCAATTATCCGCCGTACT
>probe:Drosophila_2:1631638_at:79:47; Interrogation_Position=1789; Antisense; ATCCGCCGTACTTCATTTGTATGTA

Paste this into a BLAST search page for me
GTTTGAGGACAGTTGGTTCGCCACGCAGTTGGTTCGCCACGGAGTACGAATACGAAGTAGAAACGCCAGCCTCCTGGAATCCCCGAGTACTGAGAAGGCAGGGAATTGCACCGTGTACTTTATAATTAACACACAGTATTTACCCCACTCGGTTGCGCAGAAATCTCTGACGATTTCTGACGATTCGATATTTGCCTAAAATGGTTGGCCAGTAAAAATCCACAGGGAGATTTCTGCACAAATCCTGTACTTTTAAGCGCCTTTCACTTTGTAGCGTAGCGGCTTTGTACACATTTGTTGAAGACTTTCAATTATCCGCCGTACTATCCGCCGTACTTCATTTGTATGTA

Full Affymetrix probeset data:

Annotations for 1631638_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720